Incidental Mutation 'R9260:Cd101'
ID 702159
Institutional Source Beutler Lab
Gene Symbol Cd101
Ensembl Gene ENSMUSG00000086564
Gene Name CD101 antigen
Synonyms Igsf2, LOC381460
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 100993529-101029556 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101013283 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 437 (D437E)
Ref Sequence ENSEMBL: ENSMUSP00000116643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147399] [ENSMUST00000167086]
AlphaFold A8E0Y8
Predicted Effect probably benign
Transcript: ENSMUST00000147399
AA Change: D437E

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116643
Gene: ENSMUSG00000086564
AA Change: D437E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 28 143 4.96e-8 SMART
IG 153 266 4.74e-5 SMART
IG_like 274 379 2.19e-1 SMART
IG 289 395 3.25e-3 SMART
IG 417 533 4.85e-11 SMART
IG 545 659 1.52e-3 SMART
IG 680 805 3.16e-1 SMART
IG_like 827 927 2.95e-1 SMART
IG 856 955 1.04e-1 SMART
transmembrane domain 971 993 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167086
AA Change: D433E

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126027
Gene: ENSMUSG00000086564
AA Change: D433E

DomainStartEndE-ValueType
IG 24 139 4.96e-8 SMART
IG 149 262 4.74e-5 SMART
IG_like 270 375 2.19e-1 SMART
IG 285 391 3.25e-3 SMART
IG 413 529 4.85e-11 SMART
IG 541 655 1.52e-3 SMART
IG 676 801 3.16e-1 SMART
IG_like 823 923 2.95e-1 SMART
IG 852 951 1.04e-1 SMART
transmembrane domain 967 989 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Gr-1+ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Cd101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Cd101 APN 3 101003702 missense probably damaging 1.00
IGL01443:Cd101 APN 3 101003571 missense probably benign
IGL02000:Cd101 APN 3 101012082 missense probably benign 0.11
IGL02178:Cd101 APN 3 100993766 missense probably damaging 1.00
IGL02224:Cd101 APN 3 101017002 missense probably benign
IGL02450:Cd101 APN 3 100993738 missense probably damaging 0.99
IGL02502:Cd101 APN 3 101011825 missense probably damaging 0.99
IGL02536:Cd101 APN 3 101003597 missense probably damaging 1.00
IGL02749:Cd101 APN 3 101020399 missense probably damaging 1.00
IGL02818:Cd101 APN 3 101011929 missense probably damaging 1.00
IGL02829:Cd101 APN 3 101018565 splice site probably benign
IGL02902:Cd101 APN 3 101018994 splice site probably benign
tax_day UTSW 3 101003705 missense possibly damaging 0.86
R0069:Cd101 UTSW 3 101008217 missense probably benign 0.08
R0069:Cd101 UTSW 3 101008217 missense probably benign 0.08
R0411:Cd101 UTSW 3 101018527 splice site probably null
R0486:Cd101 UTSW 3 101008092 missense possibly damaging 0.94
R0556:Cd101 UTSW 3 101020654 missense probably damaging 1.00
R0726:Cd101 UTSW 3 101020622 missense possibly damaging 0.95
R0966:Cd101 UTSW 3 101008222 missense probably benign 0.13
R1344:Cd101 UTSW 3 101018775 nonsense probably null
R1418:Cd101 UTSW 3 101018775 nonsense probably null
R1547:Cd101 UTSW 3 101018951 missense possibly damaging 0.94
R1551:Cd101 UTSW 3 101012013 missense probably damaging 0.99
R1845:Cd101 UTSW 3 101029448 splice site probably null
R1919:Cd101 UTSW 3 101018917 missense probably damaging 1.00
R1976:Cd101 UTSW 3 101008061 missense probably damaging 0.96
R2260:Cd101 UTSW 3 101016945 missense possibly damaging 0.82
R2679:Cd101 UTSW 3 100993763 missense probably benign 0.00
R2873:Cd101 UTSW 3 101003848 missense probably benign 0.00
R3606:Cd101 UTSW 3 101020597 missense probably damaging 1.00
R4201:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4202:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4205:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4349:Cd101 UTSW 3 101013314 missense possibly damaging 0.93
R4574:Cd101 UTSW 3 101013153 missense probably benign 0.02
R4601:Cd101 UTSW 3 100993888 missense possibly damaging 0.84
R4820:Cd101 UTSW 3 101022155 missense probably benign 0.01
R4910:Cd101 UTSW 3 100993889 missense probably benign 0.13
R5014:Cd101 UTSW 3 101003823 missense probably damaging 0.99
R5081:Cd101 UTSW 3 101003705 missense possibly damaging 0.86
R5396:Cd101 UTSW 3 101018810 missense probably damaging 1.00
R5425:Cd101 UTSW 3 101018686 missense probably damaging 1.00
R6193:Cd101 UTSW 3 101020462 missense probably damaging 1.00
R6210:Cd101 UTSW 3 101018643 missense probably damaging 1.00
R6732:Cd101 UTSW 3 101008199 missense probably benign 0.01
R6830:Cd101 UTSW 3 100993696 missense probably benign 0.12
R6897:Cd101 UTSW 3 101013060 missense probably damaging 1.00
R6940:Cd101 UTSW 3 101003702 missense probably damaging 1.00
R7335:Cd101 UTSW 3 101018729 missense probably benign 0.01
R7565:Cd101 UTSW 3 101018792 missense probably benign 0.00
R7880:Cd101 UTSW 3 101007866 missense probably benign 0.00
R8121:Cd101 UTSW 3 101020582 missense probably damaging 1.00
R8233:Cd101 UTSW 3 100993673 missense unknown
R8900:Cd101 UTSW 3 101018746 missense probably benign 0.19
R8960:Cd101 UTSW 3 101003501 missense probably benign 0.01
R9335:Cd101 UTSW 3 101008115 missense probably benign 0.18
X0018:Cd101 UTSW 3 101018632 missense possibly damaging 0.95
X0023:Cd101 UTSW 3 101018855 missense probably benign
X0058:Cd101 UTSW 3 101020421 missense probably damaging 1.00
Z1177:Cd101 UTSW 3 101011916 missense probably benign 0.03
Z1177:Cd101 UTSW 3 101017140 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGGCAGAGGCAATCTCCAG -3'
(R):5'- CATGGTATGGAAGAATCAACCAACTC -3'

Sequencing Primer
(F):5'- GGCAATCTCCAGCCGAAAG -3'
(R):5'- TATGGAAGAATCAACCAACTCTGATC -3'
Posted On 2022-03-25