Incidental Mutation 'R9260:Dpyd'
ID 702161
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119314798 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 830 (Y830F)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect possibly damaging
Transcript: ENSMUST00000039177
AA Change: Y830F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: Y830F

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTCCAGAGCTTCCTTTGG -3'
(R):5'- AGTACTCCTTGGTTGACACAG -3'

Sequencing Primer
(F):5'- CCAGAGCTTCCTTTGGATATCTTGG -3'
(R):5'- TACTCCTTGGTTGACACAGGAGAG -3'
Posted On 2022-03-25