Incidental Mutation 'R9260:Kcnh2'
ID 702166
Institutional Source Beutler Lab
Gene Symbol Kcnh2
Ensembl Gene ENSMUSG00000038319
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 2
Synonyms merg1a, M-erg, Lqt2, ERG1, ether a go-go related, merg1b, LQT
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 24319589-24351604 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24323071 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 866 (D866E)
Ref Sequence ENSEMBL: ENSMUSP00000047705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036092] [ENSMUST00000115098]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000036092
AA Change: D866E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047705
Gene: ENSMUSG00000038319
AA Change: D866E

DomainStartEndE-ValueType
PAS 13 87 9.54e0 SMART
PAC 93 135 1.31e-5 SMART
low complexity region 194 199 N/A INTRINSIC
Pfam:Ion_trans 409 673 7.8e-38 PFAM
Pfam:Ion_trans_2 600 667 3.2e-13 PFAM
cNMP 744 862 1.15e-24 SMART
low complexity region 885 896 N/A INTRINSIC
low complexity region 925 956 N/A INTRINSIC
low complexity region 965 982 N/A INTRINSIC
coiled coil region 1035 1069 N/A INTRINSIC
low complexity region 1082 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115098
AA Change: D524E

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110750
Gene: ENSMUSG00000038319
AA Change: D524E

DomainStartEndE-ValueType
Pfam:Ion_trans 114 319 1.4e-22 PFAM
Pfam:Ion_trans_2 257 325 2.9e-14 PFAM
cNMP 402 520 1.15e-24 SMART
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 623 640 N/A INTRINSIC
coiled coil region 693 727 N/A INTRINSIC
low complexity region 740 766 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice which maintain expression of the A isoform and lack expression of the B isoform are predisposed to episodic sinus bradycardia. Mice with mutations causing defects in both isoforms are embryonic lethal with defects in cardiac development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Fpr1 A T 17: 17,877,744 probably benign Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Hikeshi T C 7: 89,930,568 probably benign Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mkrn1 T C 6: 39,405,596 probably benign Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Nyap2 T A 1: 81,087,118 probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Usp13 T A 3: 32,901,760 probably benign Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Kcnh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Kcnh2 APN 5 24324966 missense probably damaging 1.00
IGL01536:Kcnh2 APN 5 24326524 missense probably damaging 1.00
IGL02305:Kcnh2 APN 5 24322660 missense possibly damaging 0.86
IGL02379:Kcnh2 APN 5 24326638 missense probably damaging 1.00
IGL03100:Kcnh2 APN 5 24322684 missense probably damaging 1.00
IGL03326:Kcnh2 APN 5 24326413 missense probably damaging 1.00
R0077:Kcnh2 UTSW 5 24322702 missense probably benign 0.11
R0349:Kcnh2 UTSW 5 24351237 missense probably benign 0.18
R0959:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R0960:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R0963:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R1130:Kcnh2 UTSW 5 24331825 nonsense probably null
R1147:Kcnh2 UTSW 5 24324387 missense probably damaging 1.00
R1147:Kcnh2 UTSW 5 24324387 missense probably damaging 1.00
R1201:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R1346:Kcnh2 UTSW 5 24322660 missense possibly damaging 0.86
R1608:Kcnh2 UTSW 5 24322219 missense probably benign
R1613:Kcnh2 UTSW 5 24322762 splice site probably benign
R1797:Kcnh2 UTSW 5 24322672 missense probably damaging 1.00
R2006:Kcnh2 UTSW 5 24326570 missense probably damaging 1.00
R2312:Kcnh2 UTSW 5 24324954 critical splice donor site probably null
R2435:Kcnh2 UTSW 5 24326347 critical splice donor site probably null
R4623:Kcnh2 UTSW 5 24348442 missense probably benign 0.00
R4941:Kcnh2 UTSW 5 24331087 missense probably damaging 0.98
R5394:Kcnh2 UTSW 5 24332041 missense probably benign
R5467:Kcnh2 UTSW 5 24326767 nonsense probably null
R6127:Kcnh2 UTSW 5 24325003 missense probably damaging 1.00
R6135:Kcnh2 UTSW 5 24321793 missense probably damaging 1.00
R6280:Kcnh2 UTSW 5 24331923 missense probably benign 0.43
R6936:Kcnh2 UTSW 5 24324339 missense probably damaging 1.00
R7061:Kcnh2 UTSW 5 24331922 missense probably benign 0.01
R7136:Kcnh2 UTSW 5 24332991 missense probably benign 0.13
R7399:Kcnh2 UTSW 5 24322059 missense probably damaging 0.99
R7479:Kcnh2 UTSW 5 24325492 critical splice donor site probably null
R7860:Kcnh2 UTSW 5 24324563 missense probably damaging 1.00
R7950:Kcnh2 UTSW 5 24333036 missense probably benign 0.31
R8018:Kcnh2 UTSW 5 24320016 missense probably damaging 0.98
R8063:Kcnh2 UTSW 5 24321672 missense probably benign 0.20
R8517:Kcnh2 UTSW 5 24326638 missense probably damaging 1.00
R8681:Kcnh2 UTSW 5 24331983 missense probably benign 0.03
R8992:Kcnh2 UTSW 5 24331870 missense probably benign 0.00
R9348:Kcnh2 UTSW 5 24333005 missense probably damaging 1.00
R9349:Kcnh2 UTSW 5 24333005 missense probably damaging 1.00
R9416:Kcnh2 UTSW 5 24332966 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCCTTCCTTAACCTAGGG -3'
(R):5'- AGCCTCTGAACCTATATGCCCG -3'

Sequencing Primer
(F):5'- GAAGAATTTTCCCTACCCCCATC -3'
(R):5'- ATATGCCCGTCCTGGAAAGTC -3'
Posted On 2022-03-25