Incidental Mutation 'R9260:Kcnh2'
ID 702166
Institutional Source Beutler Lab
Gene Symbol Kcnh2
Ensembl Gene ENSMUSG00000038319
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 2
Synonyms LQT, merg1b, merg1a, ether a go-go related, M-erg, ERG1, Lqt2
MMRRC Submission 068962-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.708) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 24524587-24556602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24528069 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 866 (D866E)
Ref Sequence ENSEMBL: ENSMUSP00000047705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036092] [ENSMUST00000115098]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000036092
AA Change: D866E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047705
Gene: ENSMUSG00000038319
AA Change: D866E

DomainStartEndE-ValueType
PAS 13 87 9.54e0 SMART
PAC 93 135 1.31e-5 SMART
low complexity region 194 199 N/A INTRINSIC
Pfam:Ion_trans 409 673 7.8e-38 PFAM
Pfam:Ion_trans_2 600 667 3.2e-13 PFAM
cNMP 744 862 1.15e-24 SMART
low complexity region 885 896 N/A INTRINSIC
low complexity region 925 956 N/A INTRINSIC
low complexity region 965 982 N/A INTRINSIC
coiled coil region 1035 1069 N/A INTRINSIC
low complexity region 1082 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115098
AA Change: D524E

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110750
Gene: ENSMUSG00000038319
AA Change: D524E

DomainStartEndE-ValueType
Pfam:Ion_trans 114 319 1.4e-22 PFAM
Pfam:Ion_trans_2 257 325 2.9e-14 PFAM
cNMP 402 520 1.15e-24 SMART
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 623 640 N/A INTRINSIC
coiled coil region 693 727 N/A INTRINSIC
low complexity region 740 766 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice which maintain expression of the A isoform and lack expression of the B isoform are predisposed to episodic sinus bradycardia. Mice with mutations causing defects in both isoforms are embryonic lethal with defects in cardiac development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1a4 A G 1: 172,074,359 (GRCm39) I298T probably damaging Het
Bmper T A 9: 23,318,016 (GRCm39) L545H probably benign Het
Cacnb3 A G 15: 98,537,438 (GRCm39) S39G probably benign Het
Casr T C 16: 36,330,326 (GRCm39) K336R probably benign Het
Ccdc141 C A 2: 76,844,795 (GRCm39) G1424V probably damaging Het
Cd101 A T 3: 100,920,599 (GRCm39) D437E probably benign Het
Chadl A G 15: 81,578,058 (GRCm39) S524P probably damaging Het
Cimap2 T C 4: 106,472,634 (GRCm39) K84E probably benign Het
Clec4a4 C T 6: 123,000,895 (GRCm39) R203* probably null Het
Cntnap4 A G 8: 113,500,276 (GRCm39) I523V probably benign Het
Cpb1 T A 3: 20,316,638 (GRCm39) Y304F probably damaging Het
Dnajc14 T G 10: 128,642,766 (GRCm39) S229R possibly damaging Het
Dnajc15 A G 14: 78,081,839 (GRCm39) V101A possibly damaging Het
Dpyd A T 3: 119,108,447 (GRCm39) Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,769,278 (GRCm39) V675A probably benign Het
F10 G A 8: 13,105,638 (GRCm39) C413Y probably damaging Het
Fam47e C T 5: 92,735,384 (GRCm39) L206F probably damaging Het
Fpr1 A T 17: 18,098,006 (GRCm39) probably benign Het
Frem2 G C 3: 53,560,204 (GRCm39) S1434R probably damaging Het
Gli3 G T 13: 15,899,675 (GRCm39) V1021F probably damaging Het
Gm7168 A T 17: 14,169,488 (GRCm39) N285I probably benign Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Herc1 T A 9: 66,325,691 (GRCm39) C1388* probably null Het
Hikeshi T C 7: 89,579,776 (GRCm39) probably benign Het
Hjv T A 3: 96,435,579 (GRCm39) I279N probably damaging Het
Igfn1 T C 1: 135,907,694 (GRCm39) E217G probably benign Het
Ighv1-59 T C 12: 115,298,737 (GRCm39) T106A probably benign Het
Igkv6-23 T A 6: 70,237,457 (GRCm39) I95F probably damaging Het
Il31ra A T 13: 112,668,202 (GRCm39) S456T probably damaging Het
Ints3 T C 3: 90,308,468 (GRCm39) D610G probably damaging Het
Iqcg G A 16: 32,855,973 (GRCm39) Q201* probably null Het
Kat14 T A 2: 144,235,441 (GRCm39) D300E probably benign Het
Kbtbd13 T C 9: 65,298,852 (GRCm39) H28R possibly damaging Het
Kdm4b A G 17: 56,701,775 (GRCm39) T595A probably benign Het
Lct C T 1: 128,227,704 (GRCm39) W1263* probably null Het
Micall2 T A 5: 139,695,453 (GRCm39) M905L unknown Het
Mkrn1 T C 6: 39,382,530 (GRCm39) probably benign Het
Mobp A G 9: 119,997,572 (GRCm39) T164A unknown Het
Mtrr T C 13: 68,728,674 (GRCm39) E42G possibly damaging Het
Muc5b T A 7: 141,405,255 (GRCm39) W888R unknown Het
Myh7 G A 14: 55,224,842 (GRCm39) A575V probably damaging Het
Nbea A C 3: 55,891,233 (GRCm39) L1612W possibly damaging Het
Notch3 A G 17: 32,362,216 (GRCm39) probably null Het
Nsun4 T C 4: 115,902,007 (GRCm39) Y153C probably damaging Het
Nup210 A G 6: 91,039,785 (GRCm39) I690T probably benign Het
Nyap2 T A 1: 81,064,835 (GRCm39) probably benign Het
Oaz1 T A 10: 80,662,603 (GRCm39) S4T possibly damaging Het
Optn C T 2: 5,045,076 (GRCm39) C222Y probably benign Het
Or11i1 A G 3: 106,729,510 (GRCm39) S122P probably damaging Het
Or4f17-ps1 T A 2: 111,358,271 (GRCm39) V222E Het
Or5ac19 T C 16: 59,089,677 (GRCm39) M118V probably damaging Het
Or6c76b G A 10: 129,692,458 (GRCm39) V24M probably benign Het
Or7a40 A T 16: 16,491,337 (GRCm39) C169* probably null Het
Osmr T A 15: 6,882,033 (GRCm39) H37L probably benign Het
Pccb G T 9: 100,877,643 (GRCm39) P287Q probably benign Het
Pclo T A 5: 14,764,287 (GRCm39) D4253E unknown Het
Pdcd6ip A T 9: 113,526,572 (GRCm39) probably null Het
Pde9a T C 17: 31,678,137 (GRCm39) probably null Het
Pdk2 C A 11: 94,930,260 (GRCm39) V59F probably damaging Het
Pgm1 T A 4: 99,827,186 (GRCm39) V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,117,943 (GRCm39) probably benign Het
Pold4 T C 19: 4,282,904 (GRCm39) F97S possibly damaging Het
Ppp5c C T 7: 16,740,886 (GRCm39) V361I probably benign Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Psmb11 A T 14: 54,863,033 (GRCm39) I84F probably damaging Het
Smg7 A G 1: 152,737,549 (GRCm39) S131P probably damaging Het
Snrnp200 T A 2: 127,078,428 (GRCm39) L1728Q probably damaging Het
Stbd1 A T 5: 92,753,456 (GRCm39) E315D probably damaging Het
Tcaf1 C T 6: 42,663,554 (GRCm39) G109R possibly damaging Het
Thap12 C T 7: 98,356,280 (GRCm39) R56* probably null Het
Ttn T C 2: 76,645,919 (GRCm39) E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Uqcrfs1 G A 13: 30,725,108 (GRCm39) A144V probably damaging Het
Usp13 T A 3: 32,955,909 (GRCm39) probably benign Het
Wdr19 T A 5: 65,363,789 (GRCm39) D67E possibly damaging Het
Zfp998 A T 13: 66,579,375 (GRCm39) H369Q unknown Het
Zkscan3 A T 13: 21,578,210 (GRCm39) W226R probably damaging Het
Zmym5 A C 14: 57,041,641 (GRCm39) F154C probably damaging Het
Other mutations in Kcnh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Kcnh2 APN 5 24,529,964 (GRCm39) missense probably damaging 1.00
IGL01536:Kcnh2 APN 5 24,531,522 (GRCm39) missense probably damaging 1.00
IGL02305:Kcnh2 APN 5 24,527,658 (GRCm39) missense possibly damaging 0.86
IGL02379:Kcnh2 APN 5 24,531,636 (GRCm39) missense probably damaging 1.00
IGL03100:Kcnh2 APN 5 24,527,682 (GRCm39) missense probably damaging 1.00
IGL03326:Kcnh2 APN 5 24,531,411 (GRCm39) missense probably damaging 1.00
R0077:Kcnh2 UTSW 5 24,527,700 (GRCm39) missense probably benign 0.11
R0349:Kcnh2 UTSW 5 24,556,235 (GRCm39) missense probably benign 0.18
R0959:Kcnh2 UTSW 5 24,527,670 (GRCm39) missense probably damaging 1.00
R0960:Kcnh2 UTSW 5 24,527,670 (GRCm39) missense probably damaging 1.00
R0963:Kcnh2 UTSW 5 24,527,670 (GRCm39) missense probably damaging 1.00
R1130:Kcnh2 UTSW 5 24,536,823 (GRCm39) nonsense probably null
R1147:Kcnh2 UTSW 5 24,529,385 (GRCm39) missense probably damaging 1.00
R1147:Kcnh2 UTSW 5 24,529,385 (GRCm39) missense probably damaging 1.00
R1201:Kcnh2 UTSW 5 24,527,670 (GRCm39) missense probably damaging 1.00
R1346:Kcnh2 UTSW 5 24,527,658 (GRCm39) missense possibly damaging 0.86
R1608:Kcnh2 UTSW 5 24,527,217 (GRCm39) missense probably benign
R1613:Kcnh2 UTSW 5 24,527,760 (GRCm39) splice site probably benign
R1797:Kcnh2 UTSW 5 24,527,670 (GRCm39) missense probably damaging 1.00
R2006:Kcnh2 UTSW 5 24,531,568 (GRCm39) missense probably damaging 1.00
R2312:Kcnh2 UTSW 5 24,529,952 (GRCm39) critical splice donor site probably null
R2435:Kcnh2 UTSW 5 24,531,345 (GRCm39) critical splice donor site probably null
R4623:Kcnh2 UTSW 5 24,553,440 (GRCm39) missense probably benign 0.00
R4941:Kcnh2 UTSW 5 24,536,085 (GRCm39) missense probably damaging 0.98
R5394:Kcnh2 UTSW 5 24,537,039 (GRCm39) missense probably benign
R5467:Kcnh2 UTSW 5 24,531,765 (GRCm39) nonsense probably null
R6127:Kcnh2 UTSW 5 24,530,001 (GRCm39) missense probably damaging 1.00
R6135:Kcnh2 UTSW 5 24,526,791 (GRCm39) missense probably damaging 1.00
R6280:Kcnh2 UTSW 5 24,536,921 (GRCm39) missense probably benign 0.43
R6936:Kcnh2 UTSW 5 24,529,337 (GRCm39) missense probably damaging 1.00
R7061:Kcnh2 UTSW 5 24,536,920 (GRCm39) missense probably benign 0.01
R7136:Kcnh2 UTSW 5 24,537,989 (GRCm39) missense probably benign 0.13
R7399:Kcnh2 UTSW 5 24,527,057 (GRCm39) missense probably damaging 0.99
R7479:Kcnh2 UTSW 5 24,530,490 (GRCm39) critical splice donor site probably null
R7860:Kcnh2 UTSW 5 24,529,561 (GRCm39) missense probably damaging 1.00
R7950:Kcnh2 UTSW 5 24,538,034 (GRCm39) missense probably benign 0.31
R8018:Kcnh2 UTSW 5 24,525,014 (GRCm39) missense probably damaging 0.98
R8063:Kcnh2 UTSW 5 24,526,670 (GRCm39) missense probably benign 0.20
R8517:Kcnh2 UTSW 5 24,531,636 (GRCm39) missense probably damaging 1.00
R8681:Kcnh2 UTSW 5 24,536,981 (GRCm39) missense probably benign 0.03
R8992:Kcnh2 UTSW 5 24,536,868 (GRCm39) missense probably benign 0.00
R9348:Kcnh2 UTSW 5 24,538,003 (GRCm39) missense probably damaging 1.00
R9349:Kcnh2 UTSW 5 24,538,003 (GRCm39) missense probably damaging 1.00
R9416:Kcnh2 UTSW 5 24,537,964 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCCTTCCTTAACCTAGGG -3'
(R):5'- AGCCTCTGAACCTATATGCCCG -3'

Sequencing Primer
(F):5'- GAAGAATTTTCCCTACCCCCATC -3'
(R):5'- ATATGCCCGTCCTGGAAAGTC -3'
Posted On 2022-03-25