Incidental Mutation 'R9260:Tcaf1'
ID 702171
Institutional Source Beutler Lab
Gene Symbol Tcaf1
Ensembl Gene ENSMUSG00000036667
Gene Name TRPM8 channel-associated factor 1
Synonyms A230020K05Rik, 2810407D09Rik, Fam115a, 3321401G04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42668002-42710088 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 42686620 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 109 (G109R)
Ref Sequence ENSEMBL: ENSMUSP00000046137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045054] [ENSMUST00000045140] [ENSMUST00000121083]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000045054
AA Change: G109R

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046137
Gene: ENSMUSG00000036667
AA Change: G109R

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000045140
AA Change: G109R

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036379
Gene: ENSMUSG00000036667
AA Change: G109R

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121083
AA Change: G109R

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114036
Gene: ENSMUSG00000036667
AA Change: G109R

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Fpr1 A T 17: 17,877,744 probably benign Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Hikeshi T C 7: 89,930,568 probably benign Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mkrn1 T C 6: 39,405,596 probably benign Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Nyap2 T A 1: 81,087,118 probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Usp13 T A 3: 32,901,760 probably benign Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Tcaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Tcaf1 APN 6 42686622 missense probably benign
IGL02415:Tcaf1 APN 6 42686650 missense probably benign 0.00
IGL02504:Tcaf1 APN 6 42679279 missense probably benign 0.05
IGL02960:Tcaf1 APN 6 42686459 missense probably benign
IGL03022:Tcaf1 APN 6 42678126 nonsense probably null
PIT4696001:Tcaf1 UTSW 6 42678539 missense probably benign 0.00
R0103:Tcaf1 UTSW 6 42686390 missense probably benign 0.23
R0103:Tcaf1 UTSW 6 42686390 missense probably benign 0.23
R0586:Tcaf1 UTSW 6 42673539 missense probably damaging 1.00
R0717:Tcaf1 UTSW 6 42678665 missense probably benign 0.01
R0724:Tcaf1 UTSW 6 42675367 missense probably damaging 1.00
R1166:Tcaf1 UTSW 6 42678678 missense probably benign
R1472:Tcaf1 UTSW 6 42686448 missense possibly damaging 0.83
R1538:Tcaf1 UTSW 6 42678989 missense probably damaging 1.00
R1721:Tcaf1 UTSW 6 42675338 missense possibly damaging 0.90
R1776:Tcaf1 UTSW 6 42678455 missense possibly damaging 0.90
R2136:Tcaf1 UTSW 6 42673520 missense probably benign 0.01
R3433:Tcaf1 UTSW 6 42686574 missense probably damaging 0.98
R3951:Tcaf1 UTSW 6 42679059 missense probably benign 0.14
R4472:Tcaf1 UTSW 6 42679314 missense probably benign
R4740:Tcaf1 UTSW 6 42686875 missense probably benign
R4915:Tcaf1 UTSW 6 42675196 missense probably damaging 1.00
R5249:Tcaf1 UTSW 6 42676859 missense probably benign 0.00
R5340:Tcaf1 UTSW 6 42678989 missense probably damaging 1.00
R5458:Tcaf1 UTSW 6 42686542 missense probably benign
R6196:Tcaf1 UTSW 6 42676807 missense probably damaging 1.00
R6772:Tcaf1 UTSW 6 42675276 missense probably damaging 1.00
R7066:Tcaf1 UTSW 6 42679177 missense probably damaging 1.00
R7145:Tcaf1 UTSW 6 42686753 missense probably damaging 1.00
R7204:Tcaf1 UTSW 6 42675039 splice site probably null
R7529:Tcaf1 UTSW 6 42675355 missense probably damaging 1.00
R7554:Tcaf1 UTSW 6 42677454 missense probably benign 0.13
R7813:Tcaf1 UTSW 6 42673429 nonsense probably null
R8191:Tcaf1 UTSW 6 42675256 missense probably damaging 1.00
R8194:Tcaf1 UTSW 6 42675302 missense probably benign 0.06
R8532:Tcaf1 UTSW 6 42678131 missense probably damaging 0.96
R8784:Tcaf1 UTSW 6 42679287 missense probably benign
R8801:Tcaf1 UTSW 6 42686808 missense probably damaging 1.00
R8945:Tcaf1 UTSW 6 42686373 missense probably benign 0.00
R8989:Tcaf1 UTSW 6 42686773 missense probably damaging 1.00
R9076:Tcaf1 UTSW 6 42677438 missense probably benign 0.01
R9321:Tcaf1 UTSW 6 42679356 missense probably benign 0.00
R9539:Tcaf1 UTSW 6 42678749 missense probably benign 0.16
RF013:Tcaf1 UTSW 6 42679173 missense probably benign 0.04
Z1177:Tcaf1 UTSW 6 42673477 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TTCCCAGGAAATGCGAACAG -3'
(R):5'- AATGGTGAATGACGTGGGCC -3'

Sequencing Primer
(F):5'- GAACTCTATCATCATCACCCTGGG -3'
(R):5'- TGAATGACGTGGGCCAGGTC -3'
Posted On 2022-03-25