Incidental Mutation 'R9260:Herc1'
ID 702182
Institutional Source Beutler Lab
Gene Symbol Herc1
Ensembl Gene ENSMUSG00000038664
Gene Name HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms tbl, D130015N03Rik, 2810449H11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 66350450-66508775 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 66418409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 1388 (C1388*)
Ref Sequence ENSEMBL: ENSMUSP00000044801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042824]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000042824
AA Change: C1388*
SMART Domains Protein: ENSMUSP00000044801
Gene: ENSMUSG00000038664
AA Change: C1388*

low complexity region 79 90 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:RCC1 476 526 5.4e-15 PFAM
Pfam:RCC1_2 513 542 1.3e-9 PFAM
Pfam:RCC1 529 576 5.5e-16 PFAM
Pfam:RCC1 579 629 1.5e-10 PFAM
Pfam:RCC1 632 680 3.6e-9 PFAM
Pfam:RCC1_2 667 696 2.2e-11 PFAM
Pfam:RCC1 683 733 1.2e-14 PFAM
low complexity region 787 807 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1080 1100 N/A INTRINSIC
low complexity region 1348 1378 N/A INTRINSIC
low complexity region 1659 1676 N/A INTRINSIC
low complexity region 1865 1874 N/A INTRINSIC
low complexity region 2002 2030 N/A INTRINSIC
SPRY 2067 2188 1.8e-30 SMART
coiled coil region 2251 2280 N/A INTRINSIC
low complexity region 2410 2423 N/A INTRINSIC
low complexity region 2613 2629 N/A INTRINSIC
low complexity region 2633 2648 N/A INTRINSIC
low complexity region 2650 2667 N/A INTRINSIC
low complexity region 2736 2749 N/A INTRINSIC
low complexity region 2882 2896 N/A INTRINSIC
low complexity region 2924 2935 N/A INTRINSIC
low complexity region 2971 2987 N/A INTRINSIC
low complexity region 3045 3051 N/A INTRINSIC
low complexity region 3168 3186 N/A INTRINSIC
low complexity region 3191 3213 N/A INTRINSIC
low complexity region 3364 3379 N/A INTRINSIC
WD40 3415 3454 1.68e-6 SMART
WD40 3570 3608 3.68e1 SMART
WD40 3613 3652 4.3e-1 SMART
WD40 3657 3702 3.17e-2 SMART
WD40 3734 3773 8.29e-6 SMART
low complexity region 3950 3964 N/A INTRINSIC
Pfam:RCC1_2 4079 4111 7.3e-9 PFAM
Pfam:RCC1 4098 4147 3.4e-16 PFAM
Pfam:RCC1_2 4134 4163 1.8e-7 PFAM
Pfam:RCC1 4150 4199 7.2e-16 PFAM
Pfam:RCC1 4204 4252 6.1e-12 PFAM
Pfam:RCC1 4255 4304 2.4e-7 PFAM
Pfam:RCC1_2 4291 4320 5.8e-12 PFAM
Pfam:RCC1 4307 4356 8.9e-16 PFAM
Blast:HECTc 4389 4423 2e-11 BLAST
HECTc 4497 4846 8.2e-148 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gen encodes a member of the HERC protein family. This protein stimulates guanine nucleotide exchange on ARF1 and Rab proteins. This protein may be involved in membrane transport processes. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for this spontaneous mutation exhibit an abnormal cerebellar Purkinje cell layer and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Herc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Herc1 APN 9 66483966 missense probably benign 0.02
IGL00159:Herc1 APN 9 66437682 missense possibly damaging 0.94
IGL00486:Herc1 APN 9 66476120 missense probably benign
IGL00717:Herc1 APN 9 66485002 missense probably damaging 1.00
IGL00766:Herc1 APN 9 66450741 missense probably damaging 1.00
IGL00776:Herc1 APN 9 66421038 missense probably benign
IGL00987:Herc1 APN 9 66408052 missense probably benign 0.07
IGL01090:Herc1 APN 9 66469175 nonsense probably null
IGL01098:Herc1 APN 9 66461922 critical splice donor site probably null
IGL01106:Herc1 APN 9 66476438 splice site probably benign
IGL01120:Herc1 APN 9 66428880 missense probably benign
IGL01359:Herc1 APN 9 66439268 missense probably benign 0.01
IGL01360:Herc1 APN 9 66483699 missense probably benign
IGL01364:Herc1 APN 9 66399361 missense probably benign 0.00
IGL01470:Herc1 APN 9 66497636 missense possibly damaging 0.94
IGL01670:Herc1 APN 9 66487060 missense probably damaging 1.00
IGL01825:Herc1 APN 9 66399807 missense probably benign 0.00
IGL01903:Herc1 APN 9 66386872 nonsense probably null
IGL01988:Herc1 APN 9 66488075 splice site probably benign
IGL02074:Herc1 APN 9 66450983 missense probably benign
IGL02089:Herc1 APN 9 66480869 missense probably damaging 1.00
IGL02177:Herc1 APN 9 66434511 missense probably benign
IGL02300:Herc1 APN 9 66476363 missense probably benign 0.01
IGL02304:Herc1 APN 9 66476414 missense probably benign 0.06
IGL02369:Herc1 APN 9 66492011 nonsense probably null
IGL02445:Herc1 APN 9 66433482 missense possibly damaging 0.95
IGL02447:Herc1 APN 9 66497328 missense possibly damaging 0.59
IGL02549:Herc1 APN 9 66399901 missense probably damaging 0.98
IGL02571:Herc1 APN 9 66434605 splice site probably benign
IGL02709:Herc1 APN 9 66497680 missense probably damaging 0.97
IGL02717:Herc1 APN 9 66371921 nonsense probably null
IGL02726:Herc1 APN 9 66441988 missense probably benign 0.37
IGL02733:Herc1 APN 9 66450992 missense probably benign
IGL02963:Herc1 APN 9 66388823 missense probably damaging 0.99
IGL03101:Herc1 APN 9 66487997 missense probably benign
IGL03193:Herc1 APN 9 66402680 missense probably benign
IGL03203:Herc1 APN 9 66388900 critical splice donor site probably null
IGL03216:Herc1 APN 9 66478946 missense probably benign 0.06
IGL03282:Herc1 APN 9 66451459 missense probably benign 0.05
IGL03295:Herc1 APN 9 66396703 missense possibly damaging 0.56
cradle UTSW 9 66483866 splice site probably null
miracles UTSW 9 66462837 nonsense probably null
newton UTSW 9 66467803 missense probably damaging 1.00
R0907_Herc1_362 UTSW 9 66433428 missense possibly damaging 0.94
R4427_Herc1_231 UTSW 9 66496005 missense probably damaging 1.00
R5026_Herc1_363 UTSW 9 66486126 missense probably benign 0.03
stables UTSW 9 66479453 missense probably benign 0.13
strangle UTSW 9 66501188 frame shift probably null
IGL03134:Herc1 UTSW 9 66434063 critical splice acceptor site probably benign
PIT4243001:Herc1 UTSW 9 66372207 missense probably benign 0.00
PIT4486001:Herc1 UTSW 9 66372389 missense probably damaging 1.00
PIT4696001:Herc1 UTSW 9 66479009 missense probably damaging 1.00
R0044:Herc1 UTSW 9 66448175 missense probably benign 0.04
R0044:Herc1 UTSW 9 66448175 missense probably benign 0.04
R0052:Herc1 UTSW 9 66400156 missense probably damaging 0.99
R0114:Herc1 UTSW 9 66461846 missense probably damaging 0.99
R0129:Herc1 UTSW 9 66448075 missense probably damaging 1.00
R0131:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0131:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0132:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0158:Herc1 UTSW 9 66495921 nonsense probably null
R0333:Herc1 UTSW 9 66464699 splice site probably null
R0384:Herc1 UTSW 9 66481050 splice site probably benign
R0419:Herc1 UTSW 9 66446074 splice site probably benign
R0453:Herc1 UTSW 9 66399772 missense probably benign 0.20
R0458:Herc1 UTSW 9 66476381 missense probably benign 0.12
R0490:Herc1 UTSW 9 66484999 missense probably damaging 1.00
R0506:Herc1 UTSW 9 66448159 missense probably damaging 0.99
R0513:Herc1 UTSW 9 66445645 missense possibly damaging 0.96
R0628:Herc1 UTSW 9 66450881 missense probably benign 0.35
R0666:Herc1 UTSW 9 66484888 splice site probably benign
R0674:Herc1 UTSW 9 66501192 missense probably damaging 0.99
R0682:Herc1 UTSW 9 66481981 missense possibly damaging 0.95
R0690:Herc1 UTSW 9 66386838 nonsense probably null
R0701:Herc1 UTSW 9 66487950 missense probably damaging 1.00
R0766:Herc1 UTSW 9 66504840 missense probably damaging 1.00
R0850:Herc1 UTSW 9 66466670 missense probably damaging 1.00
R0907:Herc1 UTSW 9 66433428 missense possibly damaging 0.94
R0972:Herc1 UTSW 9 66372145 missense probably damaging 1.00
R0976:Herc1 UTSW 9 66439878 missense possibly damaging 0.74
R1027:Herc1 UTSW 9 66455968 missense probably benign
R1200:Herc1 UTSW 9 66486124 missense probably damaging 1.00
R1226:Herc1 UTSW 9 66416263 missense probably benign 0.00
R1364:Herc1 UTSW 9 66400093 missense probably damaging 1.00
R1395:Herc1 UTSW 9 66439181 missense probably benign 0.13
R1432:Herc1 UTSW 9 66465469 missense probably benign 0.13
R1440:Herc1 UTSW 9 66467803 missense probably damaging 1.00
R1476:Herc1 UTSW 9 66508266 missense probably damaging 1.00
R1590:Herc1 UTSW 9 66491953 splice site probably benign
R1634:Herc1 UTSW 9 66473538 missense possibly damaging 0.51
R1700:Herc1 UTSW 9 66450678 splice site probably null
R1753:Herc1 UTSW 9 66469010 missense probably damaging 1.00
R1753:Herc1 UTSW 9 66502084 critical splice donor site probably null
R1796:Herc1 UTSW 9 66388856 nonsense probably null
R1830:Herc1 UTSW 9 66497599 missense possibly damaging 0.95
R1855:Herc1 UTSW 9 66391426 missense possibly damaging 0.95
R1866:Herc1 UTSW 9 66450791 missense probably damaging 1.00
R1894:Herc1 UTSW 9 66479461 missense probably damaging 1.00
R1918:Herc1 UTSW 9 66476126 splice site probably null
R1999:Herc1 UTSW 9 66486078 missense probably benign 0.07
R2034:Herc1 UTSW 9 66441972 missense probably benign 0.01
R2138:Herc1 UTSW 9 66470307 missense possibly damaging 0.94
R2186:Herc1 UTSW 9 66439901 missense probably benign 0.45
R2192:Herc1 UTSW 9 66465406 missense probably damaging 0.99
R2312:Herc1 UTSW 9 66508281 nonsense probably null
R2338:Herc1 UTSW 9 66428969 missense possibly damaging 0.69
R3035:Herc1 UTSW 9 66483935 missense possibly damaging 0.89
R3732:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3732:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3733:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3917:Herc1 UTSW 9 66434466 missense possibly damaging 0.94
R3953:Herc1 UTSW 9 66433793 nonsense probably null
R4073:Herc1 UTSW 9 66418492 missense probably benign 0.12
R4075:Herc1 UTSW 9 66418492 missense probably benign 0.12
R4241:Herc1 UTSW 9 66448348 frame shift probably null
R4260:Herc1 UTSW 9 66448348 frame shift probably null
R4261:Herc1 UTSW 9 66448348 frame shift probably null
R4300:Herc1 UTSW 9 66489406 missense probably damaging 1.00
R4398:Herc1 UTSW 9 66479453 missense probably benign 0.13
R4426:Herc1 UTSW 9 66496005 missense probably damaging 1.00
R4427:Herc1 UTSW 9 66496005 missense probably damaging 1.00
R4590:Herc1 UTSW 9 66437664 missense probably damaging 0.97
R4630:Herc1 UTSW 9 66433714 splice site probably null
R4656:Herc1 UTSW 9 66394711 missense probably damaging 0.97
R4658:Herc1 UTSW 9 66479491 missense possibly damaging 0.50
R4663:Herc1 UTSW 9 66433378 missense probably damaging 0.98
R4675:Herc1 UTSW 9 66391458 missense probably damaging 1.00
R4678:Herc1 UTSW 9 66416269 missense probably benign 0.00
R4754:Herc1 UTSW 9 66501206 missense probably benign 0.00
R4766:Herc1 UTSW 9 66441929 missense probably benign 0.00
R4792:Herc1 UTSW 9 66495984 missense possibly damaging 0.67
R4828:Herc1 UTSW 9 66497343 splice site probably null
R4832:Herc1 UTSW 9 66495971 missense probably benign 0.11
R4879:Herc1 UTSW 9 66462837 nonsense probably null
R4948:Herc1 UTSW 9 66484902 missense probably benign
R5021:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5022:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5023:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5024:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5025:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5026:Herc1 UTSW 9 66486126 missense probably benign 0.03
R5027:Herc1 UTSW 9 66473529 missense probably benign 0.01
R5027:Herc1 UTSW 9 66504618 missense probably damaging 0.98
R5038:Herc1 UTSW 9 66476460 intron probably benign
R5041:Herc1 UTSW 9 66429045 missense possibly damaging 0.86
R5053:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5137:Herc1 UTSW 9 66448223 missense probably benign
R5197:Herc1 UTSW 9 66448504 missense probably damaging 0.99
R5207:Herc1 UTSW 9 66399869 nonsense probably null
R5247:Herc1 UTSW 9 66434551 missense probably benign 0.01
R5267:Herc1 UTSW 9 66461809 missense probably damaging 1.00
R5274:Herc1 UTSW 9 66399409 missense probably benign
R5375:Herc1 UTSW 9 66467887 missense probably damaging 0.99
R5401:Herc1 UTSW 9 66502056 missense probably damaging 1.00
R5560:Herc1 UTSW 9 66451119 missense probably benign 0.02
R5566:Herc1 UTSW 9 66465537 missense possibly damaging 0.95
R5577:Herc1 UTSW 9 66481981 missense probably damaging 0.99
R5596:Herc1 UTSW 9 66434063 critical splice acceptor site probably benign
R5665:Herc1 UTSW 9 66465435 missense probably damaging 1.00
R5744:Herc1 UTSW 9 66508193 missense probably damaging 1.00
R5802:Herc1 UTSW 9 66462878 missense probably damaging 1.00
R5822:Herc1 UTSW 9 66445612 missense probably benign 0.00
R5954:Herc1 UTSW 9 66451492 splice site probably benign
R5977:Herc1 UTSW 9 66433322 missense possibly damaging 0.77
R6022:Herc1 UTSW 9 66483685 missense probably damaging 1.00
R6043:Herc1 UTSW 9 66408154 missense probably benign
R6046:Herc1 UTSW 9 66445549 missense probably damaging 0.99
R6089:Herc1 UTSW 9 66445532 missense probably damaging 1.00
R6123:Herc1 UTSW 9 66497250 missense probably damaging 0.97
R6155:Herc1 UTSW 9 66433423 missense possibly damaging 0.95
R6190:Herc1 UTSW 9 66376381 missense possibly damaging 0.56
R6220:Herc1 UTSW 9 66433788 missense probably damaging 1.00
R6265:Herc1 UTSW 9 66372016 missense probably benign 0.05
R6348:Herc1 UTSW 9 66487976 missense possibly damaging 0.77
R6362:Herc1 UTSW 9 66471908 missense probably damaging 1.00
R6394:Herc1 UTSW 9 66395059 missense probably damaging 0.99
R6434:Herc1 UTSW 9 66486182 missense probably damaging 0.99
R6483:Herc1 UTSW 9 66448529 missense possibly damaging 0.64
R6607:Herc1 UTSW 9 66418567 missense probably benign 0.02
R6633:Herc1 UTSW 9 66439252 nonsense probably null
R6634:Herc1 UTSW 9 66437744 missense probably benign
R6693:Herc1 UTSW 9 66478976 missense probably damaging 0.99
R6695:Herc1 UTSW 9 66483866 splice site probably null
R6748:Herc1 UTSW 9 66501188 frame shift probably null
R6750:Herc1 UTSW 9 66501188 frame shift probably null
R6751:Herc1 UTSW 9 66501188 frame shift probably null
R6774:Herc1 UTSW 9 66501188 frame shift probably null
R6785:Herc1 UTSW 9 66501188 frame shift probably null
R6786:Herc1 UTSW 9 66501188 frame shift probably null
R6856:Herc1 UTSW 9 66397898 missense probably benign 0.05
R6966:Herc1 UTSW 9 66411065 missense probably benign 0.07
R7020:Herc1 UTSW 9 66486078 missense probably benign 0.07
R7109:Herc1 UTSW 9 66481889 missense probably benign 0.03
R7122:Herc1 UTSW 9 66399774 missense possibly damaging 0.69
R7209:Herc1 UTSW 9 66385032 missense possibly damaging 0.95
R7222:Herc1 UTSW 9 66467499 missense probably damaging 0.98
R7303:Herc1 UTSW 9 66450816 missense possibly damaging 0.93
R7305:Herc1 UTSW 9 66461868 missense
R7438:Herc1 UTSW 9 66394756 missense probably benign 0.00
R7535:Herc1 UTSW 9 66474853 missense probably damaging 1.00
R7585:Herc1 UTSW 9 66445547 missense probably damaging 1.00
R7603:Herc1 UTSW 9 66451383 nonsense probably null
R7670:Herc1 UTSW 9 66416347 missense probably damaging 0.99
R7705:Herc1 UTSW 9 66439834 missense possibly damaging 0.86
R7723:Herc1 UTSW 9 66371876 missense probably benign 0.24
R7730:Herc1 UTSW 9 66493190 small deletion probably benign
R7880:Herc1 UTSW 9 66508224 missense probably damaging 0.99
R7958:Herc1 UTSW 9 66486193 missense probably damaging 1.00
R7976:Herc1 UTSW 9 66434270 missense possibly damaging 0.94
R8006:Herc1 UTSW 9 66445560 nonsense probably null
R8084:Herc1 UTSW 9 66475935 missense probably benign 0.45
R8094:Herc1 UTSW 9 66493180 missense probably damaging 0.98
R8099:Herc1 UTSW 9 66372140 missense probably damaging 1.00
R8151:Herc1 UTSW 9 66433791 missense probably damaging 0.98
R8159:Herc1 UTSW 9 66461721 missense probably null
R8190:Herc1 UTSW 9 66418451 missense probably benign 0.00
R8213:Herc1 UTSW 9 66450888 missense probably damaging 0.99
R8230:Herc1 UTSW 9 66470316 missense probably damaging 0.99
R8265:Herc1 UTSW 9 66386704 nonsense probably null
R8270:Herc1 UTSW 9 66487950 missense probably damaging 1.00
R8353:Herc1 UTSW 9 66508289 missense possibly damaging 0.88
R8423:Herc1 UTSW 9 66508160 missense probably damaging 0.99
R8506:Herc1 UTSW 9 66473581 missense possibly damaging 0.52
R8523:Herc1 UTSW 9 66450942 missense probably benign
R8530:Herc1 UTSW 9 66418628 missense probably benign
R8545:Herc1 UTSW 9 66371975 nonsense probably null
R8682:Herc1 UTSW 9 66462848 missense
R8720:Herc1 UTSW 9 66481823 missense probably benign 0.38
R8792:Herc1 UTSW 9 66465486 missense probably damaging 1.00
R8915:Herc1 UTSW 9 66411174 missense probably damaging 1.00
R8964:Herc1 UTSW 9 66445590 missense probably damaging 1.00
R9056:Herc1 UTSW 9 66473500 missense probably benign 0.10
R9158:Herc1 UTSW 9 66469118 missense probably benign 0.00
R9167:Herc1 UTSW 9 66504618 missense possibly damaging 0.75
R9192:Herc1 UTSW 9 66414131 missense probably benign 0.35
R9252:Herc1 UTSW 9 66402552 missense probably damaging 1.00
R9261:Herc1 UTSW 9 66504847 missense probably damaging 0.98
R9430:Herc1 UTSW 9 66418503 nonsense probably null
R9519:Herc1 UTSW 9 66400074 missense probably damaging 0.97
R9563:Herc1 UTSW 9 66386911 critical splice donor site unknown
R9589:Herc1 UTSW 9 66465558 missense not run
RF023:Herc1 UTSW 9 66458334 missense
X0011:Herc1 UTSW 9 66400159 missense probably benign 0.28
X0067:Herc1 UTSW 9 66448524 missense probably benign 0.03
Z1176:Herc1 UTSW 9 66434576 missense probably benign
Z1177:Herc1 UTSW 9 66458425 missense probably null
Z1177:Herc1 UTSW 9 66471911 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2022-03-25