Incidental Mutation 'R0748:Zfp292'
ID 70219
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Name zinc finger protein 292
Synonyms Zfp-15, 9430062L07Rik, Zn-16, Zfp15, Zn-15, 5730450D02Rik, Krox-10
Accession Numbers
Essential gene? Probably essential (E-score: 0.843) question?
Stock # R0748 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 34803113-34882960 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 34816424 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
AlphaFold Q9Z2U2
Predicted Effect probably benign
Transcript: ENSMUST00000047950
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098163
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,401,874 (GRCm39) V718A probably damaging Het
Amigo1 A G 3: 108,095,946 (GRCm39) S482G probably damaging Het
F2rl3 A G 8: 73,489,379 (GRCm39) Q202R probably benign Het
Faap100 A G 11: 120,262,997 (GRCm39) V787A probably damaging Het
Fat4 A T 3: 38,941,977 (GRCm39) Q290L possibly damaging Het
Flnc A G 6: 29,446,343 (GRCm39) E920G probably damaging Het
Gm9881 T C 16: 90,967,313 (GRCm39) N137S unknown Het
Hps4 A G 5: 112,522,780 (GRCm39) E546G probably damaging Het
Htr2b A G 1: 86,038,528 (GRCm39) I26T probably benign Het
Insr A C 8: 3,308,841 (GRCm39) M65R probably damaging Het
Kif20a T C 18: 34,761,241 (GRCm39) probably benign Het
L3mbtl1 A T 2: 162,813,083 (GRCm39) probably benign Het
L3mbtl1 A C 2: 162,813,084 (GRCm39) probably null Het
Lcn4 T C 2: 26,558,359 (GRCm39) I175M probably damaging Het
Malt1 T A 18: 65,608,331 (GRCm39) probably null Het
Nufip1 T C 14: 76,348,508 (GRCm39) S46P probably damaging Het
Nup93 T A 8: 95,034,571 (GRCm39) Y629N probably damaging Het
Or10a49 C A 7: 108,468,357 (GRCm39) M1I probably null Het
Pcsk6 T C 7: 65,688,716 (GRCm39) probably benign Het
Rdx G C 9: 51,976,160 (GRCm39) V33L possibly damaging Het
Rnf213 T C 11: 119,364,306 (GRCm39) L4535P probably damaging Het
Rorb T A 19: 18,955,164 (GRCm39) T66S probably damaging Het
S100a9 T C 3: 90,600,198 (GRCm39) D66G possibly damaging Het
Sacs T C 14: 61,446,714 (GRCm39) I2920T probably damaging Het
Safb2 T C 17: 56,882,580 (GRCm39) N351S probably benign Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Unc13b G A 4: 43,241,164 (GRCm39) probably benign Het
Vars1 A G 17: 35,216,988 (GRCm39) S489P probably damaging Het
Wars2 A G 3: 99,123,888 (GRCm39) K250E probably damaging Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34,808,683 (GRCm39) missense probably benign 0.15
IGL00502:Zfp292 APN 4 34,809,775 (GRCm39) missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34,808,790 (GRCm39) missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34,807,827 (GRCm39) missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34,806,763 (GRCm39) missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34,807,961 (GRCm39) missense probably benign 0.01
IGL01639:Zfp292 APN 4 34,809,048 (GRCm39) missense probably benign 0.04
IGL01688:Zfp292 APN 4 34,807,855 (GRCm39) missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34,809,244 (GRCm39) missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34,808,810 (GRCm39) missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34,805,416 (GRCm39) missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34,806,462 (GRCm39) missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34,809,415 (GRCm39) missense probably benign 0.14
IGL02715:Zfp292 APN 4 34,819,542 (GRCm39) missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34,806,163 (GRCm39) missense probably benign 0.00
F5770:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34,807,524 (GRCm39) missense probably benign 0.00
R0153:Zfp292 UTSW 4 34,811,185 (GRCm39) missense probably benign 0.26
R0184:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34,806,281 (GRCm39) missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34,808,227 (GRCm39) missense probably benign 0.25
R0433:Zfp292 UTSW 4 34,839,959 (GRCm39) missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34,810,059 (GRCm39) missense probably benign 0.28
R0555:Zfp292 UTSW 4 34,807,194 (GRCm39) missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34,807,399 (GRCm39) missense probably benign 0.02
R0782:Zfp292 UTSW 4 34,839,382 (GRCm39) missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34,809,114 (GRCm39) missense probably benign 0.00
R0879:Zfp292 UTSW 4 34,811,218 (GRCm39) missense probably benign 0.00
R1083:Zfp292 UTSW 4 34,807,569 (GRCm39) missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34,805,238 (GRCm39) missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34,805,397 (GRCm39) missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34,808,935 (GRCm39) missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34,811,237 (GRCm39) missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34,811,043 (GRCm39) missense probably benign 0.02
R1837:Zfp292 UTSW 4 34,810,264 (GRCm39) missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34,807,452 (GRCm39) missense probably benign 0.22
R2107:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34,810,266 (GRCm39) missense probably benign 0.13
R2182:Zfp292 UTSW 4 34,807,417 (GRCm39) missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34,807,962 (GRCm39) missense probably benign 0.07
R2306:Zfp292 UTSW 4 34,809,468 (GRCm39) missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34,811,281 (GRCm39) missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34,806,426 (GRCm39) missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34,808,814 (GRCm39) missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34,810,326 (GRCm39) missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34,807,744 (GRCm39) missense probably benign 0.00
R4006:Zfp292 UTSW 4 34,809,611 (GRCm39) missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34,806,079 (GRCm39) missense probably benign 0.04
R4641:Zfp292 UTSW 4 34,807,828 (GRCm39) missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34,807,078 (GRCm39) missense probably benign 0.00
R4718:Zfp292 UTSW 4 34,819,521 (GRCm39) missense possibly damaging 0.92
R4865:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34,808,917 (GRCm39) missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34,839,878 (GRCm39) missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34,809,755 (GRCm39) missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34,805,842 (GRCm39) missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34,807,491 (GRCm39) missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34,806,261 (GRCm39) missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34,811,703 (GRCm39) missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34,806,747 (GRCm39) missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34,805,125 (GRCm39) missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34,805,464 (GRCm39) missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34,809,784 (GRCm39) missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34,811,902 (GRCm39) missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34,808,497 (GRCm39) missense probably benign 0.13
R6209:Zfp292 UTSW 4 34,809,442 (GRCm39) missense probably benign 0.14
R6275:Zfp292 UTSW 4 34,808,883 (GRCm39) missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34,816,301 (GRCm39) missense probably benign 0.21
R6747:Zfp292 UTSW 4 34,806,894 (GRCm39) missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34,807,812 (GRCm39) missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34,816,357 (GRCm39) missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34,809,784 (GRCm39) missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34,806,796 (GRCm39) missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34,808,679 (GRCm39) missense probably benign
R7254:Zfp292 UTSW 4 34,819,476 (GRCm39) missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34,806,839 (GRCm39) missense probably benign
R7378:Zfp292 UTSW 4 34,808,384 (GRCm39) missense probably benign 0.26
R7535:Zfp292 UTSW 4 34,811,487 (GRCm39) missense probably benign 0.28
R7589:Zfp292 UTSW 4 34,806,777 (GRCm39) missense probably damaging 1.00
R7816:Zfp292 UTSW 4 34,809,865 (GRCm39) missense probably benign 0.02
R7979:Zfp292 UTSW 4 34,809,198 (GRCm39) missense probably benign 0.02
R7997:Zfp292 UTSW 4 34,808,688 (GRCm39) missense probably damaging 0.96
R8129:Zfp292 UTSW 4 34,807,386 (GRCm39) missense probably damaging 1.00
R8211:Zfp292 UTSW 4 34,806,163 (GRCm39) missense probably benign 0.00
R8302:Zfp292 UTSW 4 34,810,893 (GRCm39) missense possibly damaging 0.64
R8500:Zfp292 UTSW 4 34,826,691 (GRCm39) critical splice donor site probably null
R8709:Zfp292 UTSW 4 34,805,982 (GRCm39) missense probably damaging 1.00
R8947:Zfp292 UTSW 4 34,811,835 (GRCm39) missense probably damaging 1.00
R9099:Zfp292 UTSW 4 34,809,228 (GRCm39) missense possibly damaging 0.53
R9190:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R9256:Zfp292 UTSW 4 34,839,899 (GRCm39) missense probably benign 0.02
R9371:Zfp292 UTSW 4 34,810,800 (GRCm39) missense probably damaging 1.00
R9492:Zfp292 UTSW 4 34,810,794 (GRCm39) missense probably benign 0.12
R9574:Zfp292 UTSW 4 34,839,460 (GRCm39) missense probably damaging 1.00
V7580:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
Z1177:Zfp292 UTSW 4 34,811,058 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGTCCAAAACGCTAAAGTGAAAGA -3'
(R):5'- TGCCTTGTTAGATGTTATGCACACAGA -3'

Sequencing Primer
(F):5'- TTAACAGGGAAAGCTGCCG -3'
(R):5'- AGATGTTATGCACACAGACTTTG -3'
Posted On 2013-09-30