Incidental Mutation 'R9260:Gli3'
ID 702193
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms Bph, brachyphalangy
MMRRC Submission 068962-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 15638308-15904611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 15899675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1021 (V1021F)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
AlphaFold Q61602
Predicted Effect probably damaging
Transcript: ENSMUST00000110510
AA Change: V1021F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: V1021F

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1a4 A G 1: 172,074,359 (GRCm39) I298T probably damaging Het
Bmper T A 9: 23,318,016 (GRCm39) L545H probably benign Het
Cacnb3 A G 15: 98,537,438 (GRCm39) S39G probably benign Het
Casr T C 16: 36,330,326 (GRCm39) K336R probably benign Het
Ccdc141 C A 2: 76,844,795 (GRCm39) G1424V probably damaging Het
Cd101 A T 3: 100,920,599 (GRCm39) D437E probably benign Het
Chadl A G 15: 81,578,058 (GRCm39) S524P probably damaging Het
Cimap2 T C 4: 106,472,634 (GRCm39) K84E probably benign Het
Clec4a4 C T 6: 123,000,895 (GRCm39) R203* probably null Het
Cntnap4 A G 8: 113,500,276 (GRCm39) I523V probably benign Het
Cpb1 T A 3: 20,316,638 (GRCm39) Y304F probably damaging Het
Dnajc14 T G 10: 128,642,766 (GRCm39) S229R possibly damaging Het
Dnajc15 A G 14: 78,081,839 (GRCm39) V101A possibly damaging Het
Dpyd A T 3: 119,108,447 (GRCm39) Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,769,278 (GRCm39) V675A probably benign Het
F10 G A 8: 13,105,638 (GRCm39) C413Y probably damaging Het
Fam47e C T 5: 92,735,384 (GRCm39) L206F probably damaging Het
Fpr1 A T 17: 18,098,006 (GRCm39) probably benign Het
Frem2 G C 3: 53,560,204 (GRCm39) S1434R probably damaging Het
Gm7168 A T 17: 14,169,488 (GRCm39) N285I probably benign Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Herc1 T A 9: 66,325,691 (GRCm39) C1388* probably null Het
Hikeshi T C 7: 89,579,776 (GRCm39) probably benign Het
Hjv T A 3: 96,435,579 (GRCm39) I279N probably damaging Het
Igfn1 T C 1: 135,907,694 (GRCm39) E217G probably benign Het
Ighv1-59 T C 12: 115,298,737 (GRCm39) T106A probably benign Het
Igkv6-23 T A 6: 70,237,457 (GRCm39) I95F probably damaging Het
Il31ra A T 13: 112,668,202 (GRCm39) S456T probably damaging Het
Ints3 T C 3: 90,308,468 (GRCm39) D610G probably damaging Het
Iqcg G A 16: 32,855,973 (GRCm39) Q201* probably null Het
Kat14 T A 2: 144,235,441 (GRCm39) D300E probably benign Het
Kbtbd13 T C 9: 65,298,852 (GRCm39) H28R possibly damaging Het
Kcnh2 A T 5: 24,528,069 (GRCm39) D866E probably damaging Het
Kdm4b A G 17: 56,701,775 (GRCm39) T595A probably benign Het
Lct C T 1: 128,227,704 (GRCm39) W1263* probably null Het
Micall2 T A 5: 139,695,453 (GRCm39) M905L unknown Het
Mkrn1 T C 6: 39,382,530 (GRCm39) probably benign Het
Mobp A G 9: 119,997,572 (GRCm39) T164A unknown Het
Mtrr T C 13: 68,728,674 (GRCm39) E42G possibly damaging Het
Muc5b T A 7: 141,405,255 (GRCm39) W888R unknown Het
Myh7 G A 14: 55,224,842 (GRCm39) A575V probably damaging Het
Nbea A C 3: 55,891,233 (GRCm39) L1612W possibly damaging Het
Notch3 A G 17: 32,362,216 (GRCm39) probably null Het
Nsun4 T C 4: 115,902,007 (GRCm39) Y153C probably damaging Het
Nup210 A G 6: 91,039,785 (GRCm39) I690T probably benign Het
Nyap2 T A 1: 81,064,835 (GRCm39) probably benign Het
Oaz1 T A 10: 80,662,603 (GRCm39) S4T possibly damaging Het
Optn C T 2: 5,045,076 (GRCm39) C222Y probably benign Het
Or11i1 A G 3: 106,729,510 (GRCm39) S122P probably damaging Het
Or4f17-ps1 T A 2: 111,358,271 (GRCm39) V222E Het
Or5ac19 T C 16: 59,089,677 (GRCm39) M118V probably damaging Het
Or6c76b G A 10: 129,692,458 (GRCm39) V24M probably benign Het
Or7a40 A T 16: 16,491,337 (GRCm39) C169* probably null Het
Osmr T A 15: 6,882,033 (GRCm39) H37L probably benign Het
Pccb G T 9: 100,877,643 (GRCm39) P287Q probably benign Het
Pclo T A 5: 14,764,287 (GRCm39) D4253E unknown Het
Pdcd6ip A T 9: 113,526,572 (GRCm39) probably null Het
Pde9a T C 17: 31,678,137 (GRCm39) probably null Het
Pdk2 C A 11: 94,930,260 (GRCm39) V59F probably damaging Het
Pgm1 T A 4: 99,827,186 (GRCm39) V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,117,943 (GRCm39) probably benign Het
Pold4 T C 19: 4,282,904 (GRCm39) F97S possibly damaging Het
Ppp5c C T 7: 16,740,886 (GRCm39) V361I probably benign Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Psmb11 A T 14: 54,863,033 (GRCm39) I84F probably damaging Het
Smg7 A G 1: 152,737,549 (GRCm39) S131P probably damaging Het
Snrnp200 T A 2: 127,078,428 (GRCm39) L1728Q probably damaging Het
Stbd1 A T 5: 92,753,456 (GRCm39) E315D probably damaging Het
Tcaf1 C T 6: 42,663,554 (GRCm39) G109R possibly damaging Het
Thap12 C T 7: 98,356,280 (GRCm39) R56* probably null Het
Ttn T C 2: 76,645,919 (GRCm39) E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Uqcrfs1 G A 13: 30,725,108 (GRCm39) A144V probably damaging Het
Usp13 T A 3: 32,955,909 (GRCm39) probably benign Het
Wdr19 T A 5: 65,363,789 (GRCm39) D67E possibly damaging Het
Zfp998 A T 13: 66,579,375 (GRCm39) H369Q unknown Het
Zkscan3 A T 13: 21,578,210 (GRCm39) W226R probably damaging Het
Zmym5 A C 14: 57,041,641 (GRCm39) F154C probably damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15,818,884 (GRCm39) missense probably damaging 1.00
IGL00471:Gli3 APN 13 15,898,354 (GRCm39) critical splice donor site probably null
IGL00484:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15,722,983 (GRCm39) critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15,823,219 (GRCm39) missense probably damaging 1.00
IGL01799:Gli3 APN 13 15,900,746 (GRCm39) missense probably benign 0.00
IGL01861:Gli3 APN 13 15,899,910 (GRCm39) missense probably damaging 1.00
IGL02063:Gli3 APN 13 15,900,957 (GRCm39) missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15,837,099 (GRCm39) missense probably damaging 1.00
IGL02255:Gli3 APN 13 15,823,304 (GRCm39) missense probably damaging 1.00
IGL02270:Gli3 APN 13 15,901,371 (GRCm39) utr 3 prime probably benign
IGL02336:Gli3 APN 13 15,894,874 (GRCm39) missense probably damaging 1.00
IGL02346:Gli3 APN 13 15,898,278 (GRCm39) missense probably damaging 1.00
IGL02744:Gli3 APN 13 15,788,471 (GRCm39) critical splice donor site probably null
IGL02877:Gli3 APN 13 15,899,327 (GRCm39) missense probably damaging 1.00
IGL02975:Gli3 APN 13 15,899,153 (GRCm39) missense probably damaging 1.00
IGL03018:Gli3 APN 13 15,834,717 (GRCm39) missense probably damaging 1.00
IGL03378:Gli3 APN 13 15,819,005 (GRCm39) missense probably damaging 1.00
IGL03406:Gli3 APN 13 15,823,166 (GRCm39) missense probably damaging 1.00
Capone UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
Carpals UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
Ness UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15,818,942 (GRCm39) missense probably damaging 1.00
R0110:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0329:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0330:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0360:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0364:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0469:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0616:Gli3 UTSW 13 15,836,991 (GRCm39) missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15,899,300 (GRCm39) missense probably damaging 1.00
R1072:Gli3 UTSW 13 15,888,190 (GRCm39) missense probably damaging 1.00
R1257:Gli3 UTSW 13 15,900,581 (GRCm39) nonsense probably null
R1270:Gli3 UTSW 13 15,898,329 (GRCm39) missense probably benign 0.02
R1424:Gli3 UTSW 13 15,900,899 (GRCm39) missense probably benign 0.00
R1481:Gli3 UTSW 13 15,788,435 (GRCm39) missense probably damaging 0.99
R1596:Gli3 UTSW 13 15,900,056 (GRCm39) missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15,900,897 (GRCm39) missense probably benign 0.00
R1721:Gli3 UTSW 13 15,900,882 (GRCm39) missense probably benign 0.27
R1797:Gli3 UTSW 13 15,888,097 (GRCm39) missense probably damaging 0.99
R1813:Gli3 UTSW 13 15,823,276 (GRCm39) missense probably damaging 1.00
R1819:Gli3 UTSW 13 15,900,377 (GRCm39) nonsense probably null
R1988:Gli3 UTSW 13 15,900,965 (GRCm39) missense probably benign
R2132:Gli3 UTSW 13 15,900,134 (GRCm39) missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15,836,977 (GRCm39) missense probably benign 0.02
R3085:Gli3 UTSW 13 15,835,526 (GRCm39) missense probably damaging 1.00
R3177:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R3277:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R4162:Gli3 UTSW 13 15,899,700 (GRCm39) missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15,898,156 (GRCm39) missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15,888,216 (GRCm39) missense probably damaging 1.00
R4979:Gli3 UTSW 13 15,899,049 (GRCm39) missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15,723,092 (GRCm39) missense probably damaging 0.99
R5395:Gli3 UTSW 13 15,889,535 (GRCm39) missense probably damaging 1.00
R5494:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R5609:Gli3 UTSW 13 15,723,038 (GRCm39) missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15,652,750 (GRCm39) critical splice donor site probably null
R5810:Gli3 UTSW 13 15,818,894 (GRCm39) missense probably damaging 0.99
R5896:Gli3 UTSW 13 15,900,765 (GRCm39) missense probably benign 0.00
R5930:Gli3 UTSW 13 15,723,210 (GRCm39) missense probably damaging 1.00
R5964:Gli3 UTSW 13 15,900,747 (GRCm39) nonsense probably null
R5985:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6224:Gli3 UTSW 13 15,899,730 (GRCm39) missense probably benign
R6278:Gli3 UTSW 13 15,899,698 (GRCm39) missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15,899,317 (GRCm39) missense probably damaging 1.00
R6383:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6523:Gli3 UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
R7072:Gli3 UTSW 13 15,900,280 (GRCm39) missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15,889,647 (GRCm39) missense probably damaging 1.00
R7228:Gli3 UTSW 13 15,899,087 (GRCm39) missense probably benign 0.00
R7327:Gli3 UTSW 13 15,900,144 (GRCm39) missense probably benign 0.02
R7451:Gli3 UTSW 13 15,900,876 (GRCm39) missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15,900,841 (GRCm39) missense probably benign 0.00
R8167:Gli3 UTSW 13 15,900,228 (GRCm39) missense probably benign 0.00
R8170:Gli3 UTSW 13 15,894,793 (GRCm39) missense probably benign
R8199:Gli3 UTSW 13 15,900,576 (GRCm39) missense probably benign 0.08
R8247:Gli3 UTSW 13 15,901,360 (GRCm39) missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15,888,133 (GRCm39) missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15,898,110 (GRCm39) missense probably damaging 1.00
R8559:Gli3 UTSW 13 15,834,717 (GRCm39) missense probably damaging 1.00
R8676:Gli3 UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
R8905:Gli3 UTSW 13 15,901,116 (GRCm39) missense probably benign 0.01
R9099:Gli3 UTSW 13 15,901,320 (GRCm39) missense probably damaging 1.00
R9317:Gli3 UTSW 13 15,889,658 (GRCm39) missense probably damaging 1.00
R9475:Gli3 UTSW 13 15,900,296 (GRCm39) missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15,788,443 (GRCm39) missense probably benign 0.00
R9571:Gli3 UTSW 13 15,900,858 (GRCm39) missense probably benign 0.00
R9621:Gli3 UTSW 13 15,901,253 (GRCm39) missense probably benign 0.01
R9704:Gli3 UTSW 13 15,898,058 (GRCm39) missense probably damaging 1.00
R9787:Gli3 UTSW 13 15,900,386 (GRCm39) missense probably damaging 0.96
RF010:Gli3 UTSW 13 15,900,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCTGAAGACCAAGATG -3'
(R):5'- GTTAGCATCAGCATCCATGGTC -3'

Sequencing Primer
(F):5'- CAAGATGGCCTTGCTAGGG -3'
(R):5'- TCAGCATCCATGGTCAGAGC -3'
Posted On 2022-03-25