Incidental Mutation 'R9260:2410141K09Rik'
ID 702196
Institutional Source Beutler Lab
Gene Symbol 2410141K09Rik
Ensembl Gene ENSMUSG00000074832
Gene Name RIKEN cDNA 2410141K09 gene
Synonyms Gt(Ayu21)35Imeg, Gt(pU21)35Imeg
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock # R9260 (G1)
Quality Score 100.013
Status Not validated
Chromosome 13
Chromosomal Location 66418114-66441118 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66431316 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 369 (H369Q)
Ref Sequence ENSEMBL: ENSMUSP00000134352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091541] [ENSMUST00000172579] [ENSMUST00000173583]
AlphaFold K7N769
Predicted Effect probably benign
Transcript: ENSMUST00000091541
SMART Domains Protein: ENSMUSP00000089126
Gene: ENSMUSG00000074832

DomainStartEndE-ValueType
KRAB 4 66 6.16e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000172579
AA Change: H369Q
SMART Domains Protein: ENSMUSP00000134352
Gene: ENSMUSG00000074832
AA Change: H369Q

DomainStartEndE-ValueType
KRAB 4 66 3.3e-15 SMART
ZnF_C2H2 75 97 1.72e-4 SMART
ZnF_C2H2 103 125 1.06e-4 SMART
ZnF_C2H2 131 153 5.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173583
SMART Domains Protein: ENSMUSP00000134048
Gene: ENSMUSG00000074832

DomainStartEndE-ValueType
KRAB 4 66 6.16e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Fpr1 A T 17: 17,877,744 probably benign Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Hikeshi T C 7: 89,930,568 probably benign Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mkrn1 T C 6: 39,405,596 probably benign Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Nyap2 T A 1: 81,087,118 probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Usp13 T A 3: 32,901,760 probably benign Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in 2410141K09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2698:2410141K09Rik UTSW 13 66433434 missense probably damaging 0.99
R2881:2410141K09Rik UTSW 13 66431270 missense probably damaging 1.00
R5217:2410141K09Rik UTSW 13 66433726 missense probably damaging 1.00
R5401:2410141K09Rik UTSW 13 66431663 missense probably benign 0.01
R5429:2410141K09Rik UTSW 13 66431828 missense probably benign 0.00
R5532:2410141K09Rik UTSW 13 66431681 missense probably damaging 1.00
R5626:2410141K09Rik UTSW 13 66431981 missense probably benign 0.00
R5686:2410141K09Rik UTSW 13 66431663 missense probably benign 0.01
R6151:2410141K09Rik UTSW 13 66431681 missense probably damaging 1.00
R6173:2410141K09Rik UTSW 13 66431549 missense probably benign 0.00
R6857:2410141K09Rik UTSW 13 66432102 missense probably benign
R7405:2410141K09Rik UTSW 13 66431059 missense unknown
R7737:2410141K09Rik UTSW 13 66433677 critical splice donor site probably null
R8482:2410141K09Rik UTSW 13 66431738 intron probably benign
Z1088:2410141K09Rik UTSW 13 66431186 missense probably damaging 1.00
Z1088:2410141K09Rik UTSW 13 66431741 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCAAAATGGGTTGGTTCTTT -3'
(R):5'- CGGTCACAGTGGTCTCAGAT -3'

Sequencing Primer
(F):5'- CCTAAGATTACTCTCCAGTATGGG -3'
(R):5'- TGGTCTCAGATATCATAAAAGAACCC -3'
Posted On 2022-03-25