Incidental Mutation 'R9260:Cacnb3'
ID 702205
Institutional Source Beutler Lab
Gene Symbol Cacnb3
Ensembl Gene ENSMUSG00000003352
Gene Name calcium channel, voltage-dependent, beta 3 subunit
Synonyms Cchb3, Beta3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 98630840-98644529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98639557 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 39 (S39G)
Ref Sequence ENSEMBL: ENSMUSP00000003442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003442] [ENSMUST00000109150] [ENSMUST00000230490]
AlphaFold P54285
Predicted Effect probably benign
Transcript: ENSMUST00000003442
AA Change: S39G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003442
Gene: ENSMUSG00000003352
AA Change: S39G

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 16 58 8.7e-22 PFAM
SH3 62 125 1.04e0 SMART
GuKc 176 357 1.3e-32 SMART
low complexity region 363 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109150
AA Change: S38G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104778
Gene: ENSMUSG00000003352
AA Change: S38G

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 15 57 2.2e-21 PFAM
SH3 61 124 1.04e0 SMART
GuKc 175 356 1.3e-32 SMART
low complexity region 362 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230490
AA Change: S39G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory beta subunit of the voltage-dependent calcium channel. Beta subunits are composed of five domains, which contribute to the regulation of surface expression and gating of calcium channels and may also play a role in the regulation of transcription factors and calcium transport. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a null allele show altered Ca2+ channel activity, hyporesponsiveness to DHP, high blood pressure on a high salt diet, and impaired calcium responses and cytokine production in CD4 T cells. Homozygotes for another null allele show enhancedNMDA activity and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Fpr1 A T 17: 17,877,744 probably benign Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Hikeshi T C 7: 89,930,568 probably benign Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mkrn1 T C 6: 39,405,596 probably benign Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Nyap2 T A 1: 81,087,118 probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Usp13 T A 3: 32,901,760 probably benign Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Cacnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Cacnb3 APN 15 98642002 nonsense probably null
IGL01298:Cacnb3 APN 15 98639853 missense probably damaging 1.00
IGL01535:Cacnb3 APN 15 98639588 missense probably benign 0.02
IGL01537:Cacnb3 APN 15 98643420 missense probably damaging 1.00
IGL02304:Cacnb3 APN 15 98642382 missense probably damaging 1.00
IGL02349:Cacnb3 APN 15 98640961 nonsense probably null
R0270:Cacnb3 UTSW 15 98642559 missense probably damaging 0.98
R1677:Cacnb3 UTSW 15 98642574 missense probably damaging 1.00
R3407:Cacnb3 UTSW 15 98641187 missense probably benign 0.19
R3408:Cacnb3 UTSW 15 98641187 missense probably benign 0.19
R4160:Cacnb3 UTSW 15 98640720 missense probably damaging 1.00
R5123:Cacnb3 UTSW 15 98639869 missense probably damaging 1.00
R5356:Cacnb3 UTSW 15 98641617 missense probably damaging 0.96
R7773:Cacnb3 UTSW 15 98639938 critical splice donor site probably null
R8459:Cacnb3 UTSW 15 98639512 missense probably damaging 1.00
R8677:Cacnb3 UTSW 15 98642050 missense probably damaging 1.00
R8714:Cacnb3 UTSW 15 98632381 unclassified probably benign
R9240:Cacnb3 UTSW 15 98642605 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGCACACAGAAGGCAGTTTTG -3'
(R):5'- AGAGACAGATGCCTCAGAGTAC -3'

Sequencing Primer
(F):5'- CAGTTTTGGGGTCAAGTCATCCC -3'
(R):5'- GATGCCTCAGAGTACCTCACG -3'
Posted On 2022-03-25