Incidental Mutation 'R9260:Olfr201'
ID 702209
Institutional Source Beutler Lab
Gene Symbol Olfr201
Ensembl Gene ENSMUSG00000074995
Gene Name olfactory receptor 201
Synonyms GA_x54KRFPKG5P-55483936-55483010, MOR182-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 59266113-59272632 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59269314 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 118 (M118V)
Ref Sequence ENSEMBL: ENSMUSP00000150660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099656] [ENSMUST00000216834]
AlphaFold Q7TS38
Predicted Effect probably damaging
Transcript: ENSMUST00000099656
AA Change: M118V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097248
Gene: ENSMUSG00000074995
AA Change: M118V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216834
AA Change: M118V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Fpr1 A T 17: 17,877,744 probably benign Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Hikeshi T C 7: 89,930,568 probably benign Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mkrn1 T C 6: 39,405,596 probably benign Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Nyap2 T A 1: 81,087,118 probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pde9a T C 17: 31,459,163 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Usp13 T A 3: 32,901,760 probably benign Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Olfr201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Olfr201 APN 16 59268850 missense probably benign 0.07
IGL01985:Olfr201 APN 16 59269079 missense probably benign
IGL02618:Olfr201 APN 16 59268927 missense probably damaging 1.00
IGL02830:Olfr201 APN 16 59269053 missense possibly damaging 0.94
PIT4449001:Olfr201 UTSW 16 59269130 missense probably damaging 1.00
R0047:Olfr201 UTSW 16 59269211 missense probably damaging 1.00
R0047:Olfr201 UTSW 16 59269211 missense probably damaging 1.00
R1035:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1037:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1163:Olfr201 UTSW 16 59269155 missense probably benign 0.23
R1225:Olfr201 UTSW 16 59269224 missense probably benign
R1519:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1583:Olfr201 UTSW 16 59269031 missense probably benign 0.00
R2075:Olfr201 UTSW 16 59268911 missense possibly damaging 0.60
R4591:Olfr201 UTSW 16 59269413 missense possibly damaging 0.94
R5547:Olfr201 UTSW 16 59269116 missense probably benign 0.35
R6132:Olfr201 UTSW 16 59269004 missense probably damaging 0.97
R6737:Olfr201 UTSW 16 59268812 missense possibly damaging 0.60
R6872:Olfr201 UTSW 16 59269598 missense probably benign 0.20
R8001:Olfr201 UTSW 16 59269109 missense probably benign 0.01
R8525:Olfr201 UTSW 16 59269208 missense probably benign 0.07
R9003:Olfr201 UTSW 16 59268900 missense probably benign 0.05
R9584:Olfr201 UTSW 16 59269217 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CACGTTAATTGTTGGATCAGTGCAAG -3'
(R):5'- TATTCCTCAGTAGCCTGGCC -3'

Sequencing Primer
(F):5'- TTGGATCAGTGCAAGAAATGTTG -3'
(R):5'- AGTAGCCTGGCCTTTGCTGAC -3'
Posted On 2022-03-25