Incidental Mutation 'R9260:Pde9a'
ID 702211
Institutional Source Beutler Lab
Gene Symbol Pde9a
Ensembl Gene ENSMUSG00000041119
Gene Name phosphodiesterase 9A
Synonyms PDE9A1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock # R9260 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 31386234-31476310 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 31459163 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047168] [ENSMUST00000047168] [ENSMUST00000124902] [ENSMUST00000127929] [ENSMUST00000131417] [ENSMUST00000134525] [ENSMUST00000136384] [ENSMUST00000137927] [ENSMUST00000141314] [ENSMUST00000143549]
AlphaFold O70628
Predicted Effect probably null
Transcript: ENSMUST00000047168
SMART Domains Protein: ENSMUSP00000038005
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
HDc 248 415 7.12e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000047168
SMART Domains Protein: ENSMUSP00000038005
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
HDc 248 415 7.12e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124902
SMART Domains Protein: ENSMUSP00000118869
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 77 3e-47 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000127929
SMART Domains Protein: ENSMUSP00000117611
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
HDc 248 415 7.12e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131417
SMART Domains Protein: ENSMUSP00000115188
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 23 7e-9 PDB
low complexity region 32 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134525
SMART Domains Protein: ENSMUSP00000121003
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
HDc 222 389 7.12e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136384
SMART Domains Protein: ENSMUSP00000116724
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 80 2e-50 PDB
SCOP:d1f0ja_ 28 80 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137927
Predicted Effect probably benign
Transcript: ENSMUST00000141314
SMART Domains Protein: ENSMUSP00000117364
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 72 3e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000143549
SMART Domains Protein: ENSMUSP00000117911
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 23 5e-9 PDB
low complexity region 32 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154392
SMART Domains Protein: ENSMUSP00000117065
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
Pfam:PDEase_I 1 73 2.2e-20 PFAM
Pfam:PDEase_I 63 126 9.7e-15 PFAM
coiled coil region 128 158 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the hydrolysis of cAMP and cGMP to their corresponding monophosphates. The encoded protein plays a role in signal transduction by regulating the intracellular concentration of these cyclic nucleotides. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit suppressed pressure-overload-induced cardiac pathobiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,316 H369Q unknown Het
Atp1a4 A G 1: 172,246,792 I298T probably damaging Het
Bmper T A 9: 23,406,720 L545H probably benign Het
Cacnb3 A G 15: 98,639,557 S39G probably benign Het
Casr T C 16: 36,509,964 K336R probably benign Het
Ccdc141 C A 2: 77,014,451 G1424V probably damaging Het
Cd101 A T 3: 101,013,283 D437E probably benign Het
Chadl A G 15: 81,693,857 S524P probably damaging Het
Clec4a4 C T 6: 123,023,936 R203* probably null Het
Cntnap4 A G 8: 112,773,644 I523V probably benign Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Dnajc14 T G 10: 128,806,897 S229R possibly damaging Het
Dnajc15 A G 14: 77,844,399 V101A possibly damaging Het
Dpyd A T 3: 119,314,798 Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,719,250 V675A probably benign Het
F10 G A 8: 13,055,638 C413Y probably damaging Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Frem2 G C 3: 53,652,783 S1434R probably damaging Het
Gli3 G T 13: 15,725,090 V1021F probably damaging Het
Gm7168 A T 17: 13,949,226 N285I probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Herc1 T A 9: 66,418,409 C1388* probably null Het
Hfe2 T A 3: 96,528,263 I279N probably damaging Het
Igfn1 T C 1: 135,979,956 E217G probably benign Het
Ighv1-59 T C 12: 115,335,117 T106A probably benign Het
Igkv6-23 T A 6: 70,260,473 I95F probably damaging Het
Il31ra A T 13: 112,531,668 S456T probably damaging Het
Ints3 T C 3: 90,401,161 D610G probably damaging Het
Iqcg G A 16: 33,035,603 Q201* probably null Het
Kat14 T A 2: 144,393,521 D300E probably benign Het
Kbtbd13 T C 9: 65,391,570 H28R possibly damaging Het
Kcnh2 A T 5: 24,323,071 D866E probably damaging Het
Kdm4b A G 17: 56,394,775 T595A probably benign Het
Lct C T 1: 128,299,967 W1263* probably null Het
Lexm T C 4: 106,615,437 K84E probably benign Het
Micall2 T A 5: 139,709,698 M905L unknown Het
Mobp A G 9: 120,168,506 T164A unknown Het
Mtrr T C 13: 68,580,555 E42G possibly damaging Het
Muc5b T A 7: 141,851,518 W888R unknown Het
Myh7 G A 14: 54,987,385 A575V probably damaging Het
Nbea A C 3: 55,983,812 L1612W possibly damaging Het
Notch3 A G 17: 32,143,242 probably null Het
Nsun4 T C 4: 116,044,810 Y153C probably damaging Het
Nup210 A G 6: 91,062,803 I690T probably benign Het
Oaz1 T A 10: 80,826,769 S4T possibly damaging Het
Olfr1293-ps T A 2: 111,527,926 V222E Het
Olfr19 A T 16: 16,673,473 C169* probably null Het
Olfr201 T C 16: 59,269,314 M118V probably damaging Het
Olfr266 A G 3: 106,822,194 S122P probably damaging Het
Olfr813 G A 10: 129,856,589 V24M probably benign Het
Optn C T 2: 5,040,265 C222Y probably benign Het
Osmr T A 15: 6,852,552 H37L probably benign Het
Pccb G T 9: 100,995,590 P287Q probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Pdcd6ip A T 9: 113,697,504 probably null Het
Pdk2 C A 11: 95,039,434 V59F probably damaging Het
Pgm2 T A 4: 99,969,989 V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,276,150 probably benign Het
Pold4 T C 19: 4,232,850 F97S possibly damaging Het
Ppp5c C T 7: 17,006,961 V361I probably benign Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Psmb11 A T 14: 54,625,576 I84F probably damaging Het
Smg7 A G 1: 152,861,798 S131P probably damaging Het
Snrnp200 T A 2: 127,236,508 L1728Q probably damaging Het
Stbd1 A T 5: 92,605,597 E315D probably damaging Het
Tcaf1 C T 6: 42,686,620 G109R possibly damaging Het
Thap12 C T 7: 98,707,073 R56* probably null Het
Ttn T C 2: 76,815,575 E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Uqcrfs1 G A 13: 30,541,125 A144V probably damaging Het
Wdr19 T A 5: 65,206,446 D67E possibly damaging Het
Zkscan3 A T 13: 21,394,040 W226R probably damaging Het
Zmym5 A C 14: 56,804,184 F154C probably damaging Het
Other mutations in Pde9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Pde9a APN 17 31443172 missense probably benign 0.03
IGL01372:Pde9a APN 17 31461711 missense probably benign 0.24
IGL01599:Pde9a APN 17 31414150 missense probably damaging 1.00
IGL02108:Pde9a APN 17 31461693 missense probably benign
IGL02113:Pde9a APN 17 31459970 missense probably benign 0.24
IGL02132:Pde9a APN 17 31453470 missense probably benign 0.15
IGL02320:Pde9a APN 17 31459085 missense probably damaging 1.00
IGL02371:Pde9a APN 17 31420285 missense possibly damaging 0.92
IGL03128:Pde9a APN 17 31459910 missense possibly damaging 0.74
R0015:Pde9a UTSW 17 31386356 splice site probably null
R0281:Pde9a UTSW 17 31455106 missense probably damaging 0.98
R0584:Pde9a UTSW 17 31459977 missense probably damaging 1.00
R1464:Pde9a UTSW 17 31473162 missense probably benign 0.06
R1464:Pde9a UTSW 17 31473162 missense probably benign 0.06
R1853:Pde9a UTSW 17 31455120 missense probably damaging 1.00
R1855:Pde9a UTSW 17 31455120 missense probably damaging 1.00
R2134:Pde9a UTSW 17 31386310 missense probably damaging 1.00
R3732:Pde9a UTSW 17 31448427 missense possibly damaging 0.60
R4066:Pde9a UTSW 17 31443838 makesense probably null
R4841:Pde9a UTSW 17 31443161 splice site probably null
R4842:Pde9a UTSW 17 31443161 splice site probably null
R4978:Pde9a UTSW 17 31473223 missense probably benign 0.01
R6826:Pde9a UTSW 17 31466440 missense probably benign 0.02
R6860:Pde9a UTSW 17 31470724 missense probably damaging 1.00
R6912:Pde9a UTSW 17 31466412 missense possibly damaging 0.95
R6963:Pde9a UTSW 17 31443887 missense probably benign 0.00
R6965:Pde9a UTSW 17 31443887 missense probably benign 0.00
R7188:Pde9a UTSW 17 31459097 missense probably damaging 0.96
R7208:Pde9a UTSW 17 31420284 missense possibly damaging 0.46
R7429:Pde9a UTSW 17 31470706 missense probably damaging 1.00
R7819:Pde9a UTSW 17 31460200 missense possibly damaging 0.67
R7896:Pde9a UTSW 17 31459967 nonsense probably null
R8306:Pde9a UTSW 17 31473212 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGACAGTACATGGGAAC -3'
(R):5'- ATATGCATCCTCCCAGGCAC -3'

Sequencing Primer
(F):5'- CGAGGGGAAACTGGTATACCTCC -3'
(R):5'- CTTCCTTGATACCAACACCC -3'
Posted On 2022-03-25