Incidental Mutation 'R0748:Hps4'
ID70222
Institutional Source Beutler Lab
Gene Symbol Hps4
Ensembl Gene ENSMUSG00000042328
Gene NameHPS4, biogenesis of lysosomal organelles complex 3 subunit 2
SynonymsBLOC-3, 2010205O06Rik, C130020P05Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R0748 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location112343083-112378414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112374914 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 546 (E546G)
Ref Sequence ENSEMBL: ENSMUSP00000107978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035279] [ENSMUST00000112359]
Predicted Effect probably damaging
Transcript: ENSMUST00000035279
AA Change: E546G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047920
Gene: ENSMUSG00000042328
AA Change: E546G

DomainStartEndE-ValueType
low complexity region 171 180 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112359
AA Change: E546G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107978
Gene: ENSMUSG00000042328
AA Change: E546G

DomainStartEndE-ValueType
low complexity region 171 180 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199500
Meta Mutation Damage Score 0.7291 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of biogenesis of lysosome-related organelles complexes (BLOC). BLOC complexes are important for the formation of endosomal-lysosomal organelles such as melanosomes and platelet dense granules. Mutations in this gene result in subtype 4 of Hermansky-Pudlak syndrome, a form of albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a spontaneous null mutation exhibit hypopigmentation, prolonged bleeding associated with a platelet defect, reduced secretion of kidney lysosomal enzymes, and resistance to diet-induced atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,876 V718A probably damaging Het
Amigo1 A G 3: 108,188,630 S482G probably damaging Het
F2rl3 A G 8: 72,762,751 Q202R probably benign Het
Faap100 A G 11: 120,372,171 V787A probably damaging Het
Fat4 A T 3: 38,887,828 Q290L possibly damaging Het
Flnc A G 6: 29,446,344 E920G probably damaging Het
Gm9881 T C 16: 91,170,425 N137S unknown Het
Htr2b A G 1: 86,110,806 I26T probably benign Het
Insr A C 8: 3,258,841 M65R probably damaging Het
Kif20a T C 18: 34,628,188 probably benign Het
L3mbtl1 A T 2: 162,971,163 probably benign Het
L3mbtl1 A C 2: 162,971,164 probably null Het
Lcn4 T C 2: 26,668,347 I175M probably damaging Het
Malt1 T A 18: 65,475,260 probably null Het
Nufip1 T C 14: 76,111,068 S46P probably damaging Het
Nup93 T A 8: 94,307,943 Y629N probably damaging Het
Olfr517 C A 7: 108,869,150 M1I probably null Het
Pcsk6 T C 7: 66,038,968 probably benign Het
Rdx G C 9: 52,064,860 V33L possibly damaging Het
Rnf213 T C 11: 119,473,480 L4535P probably damaging Het
Rorb T A 19: 18,977,800 T66S probably damaging Het
S100a9 T C 3: 90,692,891 D66G possibly damaging Het
Sacs T C 14: 61,209,265 I2920T probably damaging Het
Safb2 T C 17: 56,575,580 N351S probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Unc13b G A 4: 43,241,164 probably benign Het
Vars A G 17: 34,998,012 S489P probably damaging Het
Wars2 A G 3: 99,216,572 K250E probably damaging Het
Zfp292 A G 4: 34,816,424 probably benign Het
Other mutations in Hps4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Hps4 APN 5 112364511 splice site probably benign
IGL02331:Hps4 APN 5 112369536 missense probably benign 0.03
IGL02410:Hps4 APN 5 112370227 missense probably benign 0.07
IGL02821:Hps4 APN 5 112375441 missense probably benign 0.02
R1487:Hps4 UTSW 5 112377999 nonsense probably null
R1891:Hps4 UTSW 5 112369556 splice site probably null
R2010:Hps4 UTSW 5 112369476 missense probably damaging 1.00
R2305:Hps4 UTSW 5 112346661 missense probably damaging 0.99
R3196:Hps4 UTSW 5 112364563 missense probably damaging 1.00
R4274:Hps4 UTSW 5 112375030 intron probably benign
R4878:Hps4 UTSW 5 112375368 missense probably benign 0.12
R4988:Hps4 UTSW 5 112378153 utr 3 prime probably benign
R5843:Hps4 UTSW 5 112349430 critical splice donor site probably null
R5896:Hps4 UTSW 5 112369485 missense probably benign 0.02
R6318:Hps4 UTSW 5 112346629 missense probably damaging 1.00
R7381:Hps4 UTSW 5 112375458 missense possibly damaging 0.86
R7781:Hps4 UTSW 5 112370522 missense probably benign 0.14
R8112:Hps4 UTSW 5 112370111 missense probably benign 0.17
Z1177:Hps4 UTSW 5 112370377 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGTGCTTTAGGAGACACCGC -3'
(R):5'- CCAAAGGTTCCAACTCGGGAAACAG -3'

Sequencing Primer
(F):5'- CCGCCTGGCTGTGTTTG -3'
(R):5'- ATGGGCCACTGCCTAGC -3'
Posted On2013-09-30