Incidental Mutation 'R9261:Cubn'
ID 702222
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Name cubilin (intrinsic factor-cobalamin receptor)
Synonyms D2Wsu88e
Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9261 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 13276338-13491813 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 13278451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 3559 (D3559N)
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000091436
AA Change: D3559N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: D3559N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,698 H52L probably benign Het
Adamts7 A G 9: 90,193,344 E1043G probably benign Het
Ahnak A G 19: 9,016,139 E4929G possibly damaging Het
Clca3a2 G T 3: 144,819,397 H25N probably benign Het
Dmac2 T A 7: 25,620,920 W15R probably benign Het
Dzank1 T C 2: 144,513,424 E117G probably benign Het
Eml2 A G 7: 19,179,818 T187A probably benign Het
Eml5 A G 12: 98,856,028 V747A probably damaging Het
Esr1 T A 10: 4,969,271 S454T probably damaging Het
Evc2 A G 5: 37,380,551 T528A probably benign Het
Fbxo5 T C 10: 5,802,325 N96S probably damaging Het
Fcnb T C 2: 28,079,624 T144A probably damaging Het
Gfm2 T A 13: 97,162,861 Y363* probably null Het
Gm28710 T C 5: 16,801,549 L88P possibly damaging Het
Grwd1 C T 7: 45,825,957 R387Q probably benign Het
Gstt2 C T 10: 75,833,677 D59N possibly damaging Het
Herc1 A G 9: 66,504,847 N4783S probably damaging Het
Hydin C A 8: 110,267,415 A27E unknown Het
Ikbip A G 10: 91,096,387 T298A possibly damaging Het
Il1rap A G 16: 26,722,974 N655S possibly damaging Het
Kif21b C T 1: 136,149,424 R395C probably damaging Het
Kif3a ATTGACG A 11: 53,593,421 probably benign Het
Klhl40 A G 9: 121,779,936 D389G probably benign Het
Ly6g A G 15: 75,158,680 T116A probably damaging Het
Mast2 A G 4: 116,308,703 L1276P probably damaging Het
Mitf A G 6: 98,013,743 Q369R possibly damaging Het
Mtus2 T A 5: 148,306,643 Y192* probably null Het
Nav1 T A 1: 135,460,357 E1109D unknown Het
Nav2 A G 7: 49,597,156 E2143G probably damaging Het
Nedd4 A G 9: 72,677,374 Q119R possibly damaging Het
Nek9 A G 12: 85,313,067 V537A probably damaging Het
Notum G T 11: 120,660,148 T64K probably damaging Het
Nudcd2 A G 11: 40,739,199 N144S probably damaging Het
Nup205 A G 6: 35,199,857 E596G probably benign Het
Olfml1 T A 7: 107,567,800 L12Q possibly damaging Het
Olfr1313 T A 2: 112,072,373 D70V probably damaging Het
Olfr524 A G 7: 140,202,650 V40A probably benign Het
Olfr639 C T 7: 104,012,129 C191Y probably damaging Het
Olfr661 T A 7: 104,688,053 F13I probably benign Het
Olfr668 A T 7: 104,925,098 M222K probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Padi4 T C 4: 140,752,615 N409S probably damaging Het
Pam T A 1: 97,975,895 T38S probably benign Het
Piezo2 T C 18: 63,075,797 I1382V possibly damaging Het
Pla2g12a A T 3: 129,890,431 Q153L possibly damaging Het
Pla2g4e T A 2: 120,189,429 H180L probably benign Het
Pprc1 A G 19: 46,062,429 T169A unknown Het
Prrc2c A G 1: 162,678,053 I2592T possibly damaging Het
Ptchd3 T A 11: 121,832,130 I348N probably damaging Het
Ralgps1 T C 2: 33,336,559 D40G probably damaging Het
Rbm19 T C 5: 120,118,745 F41S probably damaging Het
Rbsn T C 6: 92,189,816 M616V probably benign Het
Ryr1 A T 7: 29,052,388 M3660K possibly damaging Het
Sidt2 A T 9: 45,950,098 V246E probably damaging Het
Slc4a4 T C 5: 89,199,709 W770R probably damaging Het
Spata31d1c T A 13: 65,036,866 S741T probably damaging Het
Stk19 T G 17: 34,832,456 Y108S possibly damaging Het
Stox2 T C 8: 47,192,406 E673G possibly damaging Het
Tax1bp1 T A 6: 52,737,131 C271S probably benign Het
Tmem161a C A 8: 70,178,922 R167S probably damaging Het
Tnrc6c T A 11: 117,714,279 V80E probably damaging Het
Trpa1 G A 1: 14,893,241 H586Y probably damaging Het
Tsr1 A G 11: 74,908,230 T746A probably damaging Het
Uqcrfs1 T C 13: 30,540,811 I249V probably damaging Het
Vmn2r84 C A 10: 130,394,107 E45D probably benign Het
Vnn3 A G 10: 23,865,709 E304G probably damaging Het
Zfp541 G A 7: 16,082,104 V839M possibly damaging Het
Zfp62 A G 11: 49,217,523 K814E probably benign Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13491820 unclassified probably benign
IGL00228:Cubn APN 2 13456697 missense probably damaging 1.00
IGL00231:Cubn APN 2 13381849 missense possibly damaging 0.89
IGL00327:Cubn APN 2 13427056 missense possibly damaging 0.73
IGL00470:Cubn APN 2 13278418 missense probably benign 0.00
IGL00519:Cubn APN 2 13282919 missense probably benign 0.00
IGL00562:Cubn APN 2 13294230 missense probably benign 0.01
IGL00678:Cubn APN 2 13467710 missense possibly damaging 0.47
IGL00834:Cubn APN 2 13381927 missense probably damaging 1.00
IGL00946:Cubn APN 2 13456623 missense probably damaging 0.98
IGL00971:Cubn APN 2 13278408 missense possibly damaging 0.77
IGL01124:Cubn APN 2 13478093 missense possibly damaging 0.62
IGL01287:Cubn APN 2 13310566 missense probably damaging 1.00
IGL01410:Cubn APN 2 13465908 missense probably benign 0.31
IGL01418:Cubn APN 2 13284041 missense probably benign 0.01
IGL01450:Cubn APN 2 13350862 splice site probably benign
IGL01534:Cubn APN 2 13465933 nonsense probably null
IGL01584:Cubn APN 2 13308661 splice site probably benign
IGL01595:Cubn APN 2 13325216 missense probably benign 0.05
IGL01625:Cubn APN 2 13306274 missense possibly damaging 0.76
IGL01732:Cubn APN 2 13489936 nonsense probably null
IGL01972:Cubn APN 2 13446072 missense possibly damaging 0.90
IGL02027:Cubn APN 2 13287594 missense probably damaging 1.00
IGL02033:Cubn APN 2 13339846 missense probably damaging 0.98
IGL02124:Cubn APN 2 13381837 missense probably damaging 0.99
IGL02335:Cubn APN 2 13427834 splice site probably null
IGL02491:Cubn APN 2 13321228 missense probably damaging 1.00
IGL02686:Cubn APN 2 13325226 missense possibly damaging 0.92
IGL02707:Cubn APN 2 13446032 missense probably damaging 0.99
IGL02746:Cubn APN 2 13445040 missense probably damaging 1.00
IGL02873:Cubn APN 2 13294370 missense probably benign 0.07
IGL02897:Cubn APN 2 13318312 missense possibly damaging 0.55
IGL03078:Cubn APN 2 13287094 missense possibly damaging 0.87
IGL03245:Cubn APN 2 13355689 missense probably benign 0.09
IGL03289:Cubn APN 2 13426967 missense probably benign 0.00
IGL03335:Cubn APN 2 13360329 missense probably damaging 1.00
IGL03355:Cubn APN 2 13478057 splice site probably null
mellow UTSW 2 13478078 missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13468852 nonsense probably null
PIT4495001:Cubn UTSW 2 13491750 missense probably benign 0.00
R0145:Cubn UTSW 2 13306432 missense probably damaging 1.00
R0220:Cubn UTSW 2 13356709 missense probably damaging 1.00
R0254:Cubn UTSW 2 13424694 missense probably benign 0.01
R0254:Cubn UTSW 2 13440514 missense possibly damaging 0.84
R0254:Cubn UTSW 2 13476035 critical splice donor site probably null
R0360:Cubn UTSW 2 13310507 splice site probably benign
R0364:Cubn UTSW 2 13310507 splice site probably benign
R0383:Cubn UTSW 2 13430959 missense probably damaging 1.00
R0419:Cubn UTSW 2 13469763 missense possibly damaging 0.77
R0419:Cubn UTSW 2 13469764 missense possibly damaging 0.87
R0498:Cubn UTSW 2 13444267 missense probably damaging 0.99
R0560:Cubn UTSW 2 13428680 missense probably damaging 1.00
R0615:Cubn UTSW 2 13360252 splice site probably null
R0735:Cubn UTSW 2 13491689 splice site probably benign
R0780:Cubn UTSW 2 13456613 missense probably damaging 1.00
R0899:Cubn UTSW 2 13362328 missense possibly damaging 0.54
R1118:Cubn UTSW 2 13336242 missense possibly damaging 0.78
R1182:Cubn UTSW 2 13445000 missense probably damaging 0.98
R1439:Cubn UTSW 2 13287568 missense probably damaging 0.96
R1450:Cubn UTSW 2 13360319 missense probably damaging 1.00
R1464:Cubn UTSW 2 13325288 missense possibly damaging 0.87
R1464:Cubn UTSW 2 13325288 missense possibly damaging 0.87
R1476:Cubn UTSW 2 13476120 missense probably benign 0.04
R1508:Cubn UTSW 2 13427105 missense probably benign 0.25
R1532:Cubn UTSW 2 13287661 missense probably damaging 1.00
R1562:Cubn UTSW 2 13427967 missense probably damaging 1.00
R1598:Cubn UTSW 2 13469789 missense probably benign 0.00
R1761:Cubn UTSW 2 13489317 critical splice donor site probably null
R1862:Cubn UTSW 2 13308561 missense probably damaging 1.00
R1874:Cubn UTSW 2 13323002 missense probably damaging 1.00
R1923:Cubn UTSW 2 13310526 missense probably damaging 1.00
R1944:Cubn UTSW 2 13278538 missense probably benign 0.01
R1960:Cubn UTSW 2 13340017 splice site probably null
R2021:Cubn UTSW 2 13308549 missense probably benign 0.09
R2137:Cubn UTSW 2 13336167 missense probably benign 0.01
R2138:Cubn UTSW 2 13444378 missense probably damaging 0.99
R2139:Cubn UTSW 2 13336167 missense probably benign 0.01
R2179:Cubn UTSW 2 13318242 missense possibly damaging 0.85
R2328:Cubn UTSW 2 13404080 nonsense probably null
R2369:Cubn UTSW 2 13491217 missense probably damaging 1.00
R2428:Cubn UTSW 2 13476150 missense probably damaging 1.00
R2435:Cubn UTSW 2 13318272 missense probably damaging 1.00
R2567:Cubn UTSW 2 13278356 splice site probably null
R2850:Cubn UTSW 2 13322953 missense probably damaging 1.00
R2853:Cubn UTSW 2 13430834 missense probably benign 0.00
R2893:Cubn UTSW 2 13358139 missense possibly damaging 0.61
R3107:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3109:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3119:Cubn UTSW 2 13358162 missense possibly damaging 0.90
R3405:Cubn UTSW 2 13333508 missense probably benign 0.00
R3703:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3704:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3705:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3764:Cubn UTSW 2 13331585 missense possibly damaging 0.79
R3792:Cubn UTSW 2 13427914 missense probably damaging 1.00
R3802:Cubn UTSW 2 13360353 missense probably benign 0.01
R3813:Cubn UTSW 2 13294325 missense probably damaging 1.00
R3845:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3846:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3900:Cubn UTSW 2 13286980 critical splice donor site probably null
R3921:Cubn UTSW 2 13326677 missense probably damaging 1.00
R4075:Cubn UTSW 2 13313999 missense possibly damaging 0.58
R4082:Cubn UTSW 2 13428563 intron probably benign
R4405:Cubn UTSW 2 13466030 missense probably damaging 1.00
R4615:Cubn UTSW 2 13428749 missense probably damaging 1.00
R4629:Cubn UTSW 2 13313979 splice site probably null
R4770:Cubn UTSW 2 13314767 missense possibly damaging 0.92
R4799:Cubn UTSW 2 13287024 missense possibly damaging 0.94
R4799:Cubn UTSW 2 13351058 missense probably damaging 1.00
R4812:Cubn UTSW 2 13459076 missense probably damaging 1.00
R4825:Cubn UTSW 2 13325225 missense probably damaging 1.00
R4934:Cubn UTSW 2 13489910 missense probably benign 0.06
R4967:Cubn UTSW 2 13348045 missense probably benign 0.01
R5187:Cubn UTSW 2 13287568 missense probably damaging 0.96
R5232:Cubn UTSW 2 13478202 nonsense probably null
R5305:Cubn UTSW 2 13388939 missense probably damaging 1.00
R5506:Cubn UTSW 2 13491695 splice site probably null
R5530:Cubn UTSW 2 13308523 missense probably damaging 1.00
R5531:Cubn UTSW 2 13350932 missense probably benign 0.00
R5737:Cubn UTSW 2 13388891 missense probably damaging 1.00
R5886:Cubn UTSW 2 13320023 splice site probably benign
R5923:Cubn UTSW 2 13486078 missense possibly damaging 0.73
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6084:Cubn UTSW 2 13430897 missense probably damaging 1.00
R6087:Cubn UTSW 2 13427847 missense probably damaging 1.00
R6133:Cubn UTSW 2 13308618 missense probably benign 0.29
R6181:Cubn UTSW 2 13349876 missense probably benign 0.31
R6301:Cubn UTSW 2 13478078 missense probably damaging 1.00
R6320:Cubn UTSW 2 13280195 missense probably damaging 1.00
R6368:Cubn UTSW 2 13430995 missense probably damaging 0.96
R6368:Cubn UTSW 2 13476123 missense probably damaging 0.98
R6383:Cubn UTSW 2 13427835 critical splice donor site probably null
R6393:Cubn UTSW 2 13355680 missense probably benign 0.08
R6408:Cubn UTSW 2 13294203 missense probably damaging 1.00
R6470:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R6532:Cubn UTSW 2 13459002 missense probably benign 0.01
R6599:Cubn UTSW 2 13310673 missense possibly damaging 0.95
R6629:Cubn UTSW 2 13430872 missense probably damaging 1.00
R6641:Cubn UTSW 2 13476064 missense probably damaging 1.00
R6800:Cubn UTSW 2 13321255 missense probably damaging 1.00
R6823:Cubn UTSW 2 13445029 missense probably benign 0.21
R6847:Cubn UTSW 2 13444253 critical splice donor site probably null
R6885:Cubn UTSW 2 13318278 missense probably damaging 1.00
R6962:Cubn UTSW 2 13348029 missense probably benign 0.03
R6973:Cubn UTSW 2 13381837 missense possibly damaging 0.61
R6975:Cubn UTSW 2 13486789 missense probably damaging 0.99
R7076:Cubn UTSW 2 13306280 missense probably benign 0.00
R7076:Cubn UTSW 2 13306281 missense probably benign 0.10
R7086:Cubn UTSW 2 13319858 missense probably damaging 0.98
R7162:Cubn UTSW 2 13342498 missense probably damaging 0.96
R7203:Cubn UTSW 2 13351003 missense probably benign 0.01
R7292:Cubn UTSW 2 13424739 missense probably damaging 0.99
R7307:Cubn UTSW 2 13340332 missense probably damaging 0.99
R7329:Cubn UTSW 2 13468771 missense probably damaging 0.99
R7395:Cubn UTSW 2 13287064 missense probably damaging 1.00
R7417:Cubn UTSW 2 13426967 missense probably benign 0.00
R7429:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7430:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7443:Cubn UTSW 2 13455509 missense probably damaging 1.00
R7699:Cubn UTSW 2 13348178 missense probably benign
R7699:Cubn UTSW 2 13489917 missense possibly damaging 0.74
R7700:Cubn UTSW 2 13348178 missense probably benign
R7700:Cubn UTSW 2 13489917 missense possibly damaging 0.74
R7751:Cubn UTSW 2 13360365 missense probably damaging 1.00
R7755:Cubn UTSW 2 13280078 missense probably benign 0.11
R7759:Cubn UTSW 2 13348150 missense probably damaging 1.00
R7903:Cubn UTSW 2 13468869 missense probably damaging 0.97
R7921:Cubn UTSW 2 13424727 missense probably benign 0.22
R7988:Cubn UTSW 2 13332355 missense probably benign 0.43
R8010:Cubn UTSW 2 13336086 critical splice donor site probably null
R8020:Cubn UTSW 2 13479178 missense probably benign 0.01
R8120:Cubn UTSW 2 13331660 missense probably damaging 1.00
R8133:Cubn UTSW 2 13388848 missense probably damaging 1.00
R8185:Cubn UTSW 2 13294318 missense probably benign 0.11
R8224:Cubn UTSW 2 13349877 missense probably benign 0.16
R8289:Cubn UTSW 2 13486802 missense probably benign 0.10
R8326:Cubn UTSW 2 13306463 missense probably benign 0.01
R8331:Cubn UTSW 2 13340242 missense probably damaging 1.00
R8338:Cubn UTSW 2 13430847 missense probably benign 0.08
R8341:Cubn UTSW 2 13428724 missense probably damaging 1.00
R8358:Cubn UTSW 2 13325160 missense probably benign 0.17
R8427:Cubn UTSW 2 13428756 missense probably benign 0.00
R8432:Cubn UTSW 2 13381799 missense probably benign 0.00
R8441:Cubn UTSW 2 13427847 missense probably damaging 1.00
R8442:Cubn UTSW 2 13314044 missense probably damaging 1.00
R8520:Cubn UTSW 2 13308520 critical splice donor site probably null
R8699:Cubn UTSW 2 13383959 missense probably damaging 1.00
R8753:Cubn UTSW 2 13308566 nonsense probably null
R8874:Cubn UTSW 2 13360346 missense possibly damaging 0.63
R9056:Cubn UTSW 2 13456655 missense probably damaging 1.00
R9079:Cubn UTSW 2 13287103 missense probably benign 0.02
R9338:Cubn UTSW 2 13381892 missense probably damaging 1.00
R9342:Cubn UTSW 2 13458956 missense probably damaging 0.99
X0018:Cubn UTSW 2 13458986 missense probably damaging 1.00
X0022:Cubn UTSW 2 13476076 missense probably damaging 1.00
X0026:Cubn UTSW 2 13342581 missense probably damaging 1.00
X0063:Cubn UTSW 2 13322962 missense probably damaging 1.00
YA93:Cubn UTSW 2 13383992 missense probably benign 0.21
Z1088:Cubn UTSW 2 13294229 missense probably benign 0.43
Z1176:Cubn UTSW 2 13381825 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAGTTACCGTTACCGTCACTG -3'
(R):5'- CCATGTTGGGCGCTTTCTAC -3'

Sequencing Primer
(F):5'- TACTCACGATGCCACAGA -3'
(R):5'- CTGGATGCTAAATGGAACCTTTGTCC -3'
Posted On 2022-03-25