Incidental Mutation 'R9261:Fcnb'
ID 702223
Institutional Source Beutler Lab
Gene Symbol Fcnb
Ensembl Gene ENSMUSG00000026835
Gene Name ficolin B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9261 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 28076378-28084885 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28079624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 144 (T144A)
Ref Sequence ENSEMBL: ENSMUSP00000028179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028179] [ENSMUST00000117486] [ENSMUST00000135472]
AlphaFold O70497
Predicted Effect probably damaging
Transcript: ENSMUST00000028179
AA Change: T144A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028179
Gene: ENSMUSG00000026835
AA Change: T144A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 1.1e-11 PFAM
FBG 101 314 1.78e-115 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117486
AA Change: T144A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112625
Gene: ENSMUSG00000026835
AA Change: T144A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 6.7e-12 PFAM
FBG 101 250 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135472
SMART Domains Protein: ENSMUSP00000119098
Gene: ENSMUSG00000026835

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 38 81 5.3e-10 PFAM
internal_repeat_1 86 107 1.19e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Streptococcus pneumoniae infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,698 H52L probably benign Het
Adamts7 A G 9: 90,193,344 E1043G probably benign Het
Ahnak A G 19: 9,016,139 E4929G possibly damaging Het
Clca3a2 G T 3: 144,819,397 H25N probably benign Het
Cubn C T 2: 13,278,451 D3559N probably damaging Het
Dmac2 T A 7: 25,620,920 W15R probably benign Het
Dzank1 T C 2: 144,513,424 E117G probably benign Het
Eml2 A G 7: 19,179,818 T187A probably benign Het
Eml5 A G 12: 98,856,028 V747A probably damaging Het
Esr1 T A 10: 4,969,271 S454T probably damaging Het
Evc2 A G 5: 37,380,551 T528A probably benign Het
Fbxo5 T C 10: 5,802,325 N96S probably damaging Het
Gfm2 T A 13: 97,162,861 Y363* probably null Het
Gm28710 T C 5: 16,801,549 L88P possibly damaging Het
Grwd1 C T 7: 45,825,957 R387Q probably benign Het
Gstt2 C T 10: 75,833,677 D59N possibly damaging Het
Herc1 A G 9: 66,504,847 N4783S probably damaging Het
Hydin C A 8: 110,267,415 A27E unknown Het
Ikbip A G 10: 91,096,387 T298A possibly damaging Het
Il1rap A G 16: 26,722,974 N655S possibly damaging Het
Kif21b C T 1: 136,149,424 R395C probably damaging Het
Kif3a ATTGACG A 11: 53,593,421 probably benign Het
Klhl40 A G 9: 121,779,936 D389G probably benign Het
Ly6g A G 15: 75,158,680 T116A probably damaging Het
Mast2 A G 4: 116,308,703 L1276P probably damaging Het
Mitf A G 6: 98,013,743 Q369R possibly damaging Het
Mtus2 T A 5: 148,306,643 Y192* probably null Het
Nav1 T A 1: 135,460,357 E1109D unknown Het
Nav2 A G 7: 49,597,156 E2143G probably damaging Het
Nedd4 A G 9: 72,677,374 Q119R possibly damaging Het
Nek9 A G 12: 85,313,067 V537A probably damaging Het
Notum G T 11: 120,660,148 T64K probably damaging Het
Nudcd2 A G 11: 40,739,199 N144S probably damaging Het
Nup205 A G 6: 35,199,857 E596G probably benign Het
Olfml1 T A 7: 107,567,800 L12Q possibly damaging Het
Olfr1313 T A 2: 112,072,373 D70V probably damaging Het
Olfr524 A G 7: 140,202,650 V40A probably benign Het
Olfr639 C T 7: 104,012,129 C191Y probably damaging Het
Olfr661 T A 7: 104,688,053 F13I probably benign Het
Olfr668 A T 7: 104,925,098 M222K probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Padi4 T C 4: 140,752,615 N409S probably damaging Het
Pam T A 1: 97,975,895 T38S probably benign Het
Piezo2 T C 18: 63,075,797 I1382V possibly damaging Het
Pla2g12a A T 3: 129,890,431 Q153L possibly damaging Het
Pla2g4e T A 2: 120,189,429 H180L probably benign Het
Pprc1 A G 19: 46,062,429 T169A unknown Het
Prrc2c A G 1: 162,678,053 I2592T possibly damaging Het
Ptchd3 T A 11: 121,832,130 I348N probably damaging Het
Ralgps1 T C 2: 33,336,559 D40G probably damaging Het
Rbm19 T C 5: 120,118,745 F41S probably damaging Het
Rbsn T C 6: 92,189,816 M616V probably benign Het
Ryr1 A T 7: 29,052,388 M3660K possibly damaging Het
Sidt2 A T 9: 45,950,098 V246E probably damaging Het
Slc4a4 T C 5: 89,199,709 W770R probably damaging Het
Spata31d1c T A 13: 65,036,866 S741T probably damaging Het
Stk19 T G 17: 34,832,456 Y108S possibly damaging Het
Stox2 T C 8: 47,192,406 E673G possibly damaging Het
Tax1bp1 T A 6: 52,737,131 C271S probably benign Het
Tmem161a C A 8: 70,178,922 R167S probably damaging Het
Tnrc6c T A 11: 117,714,279 V80E probably damaging Het
Trpa1 G A 1: 14,893,241 H586Y probably damaging Het
Tsr1 A G 11: 74,908,230 T746A probably damaging Het
Uqcrfs1 T C 13: 30,540,811 I249V probably damaging Het
Vmn2r84 C A 10: 130,394,107 E45D probably benign Het
Vnn3 A G 10: 23,865,709 E304G probably damaging Het
Zfp541 G A 7: 16,082,104 V839M possibly damaging Het
Zfp62 A G 11: 49,217,523 K814E probably benign Het
Other mutations in Fcnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Fcnb APN 2 28076801 missense probably benign 0.04
IGL02130:Fcnb APN 2 28084789 critical splice donor site probably null
IGL02348:Fcnb APN 2 28084830 missense possibly damaging 0.88
IGL02504:Fcnb APN 2 28076594 missense probably damaging 1.00
IGL03118:Fcnb APN 2 28076618 missense probably benign 0.06
IGL03179:Fcnb APN 2 28076634 missense possibly damaging 0.93
R0217:Fcnb UTSW 2 28079677 missense probably benign 0.02
R0899:Fcnb UTSW 2 28076779 missense probably damaging 1.00
R3901:Fcnb UTSW 2 28079196 missense probably damaging 1.00
R5845:Fcnb UTSW 2 28079621 critical splice donor site probably null
R5911:Fcnb UTSW 2 28076689 missense probably damaging 1.00
R6065:Fcnb UTSW 2 28079910 missense probably damaging 1.00
R6188:Fcnb UTSW 2 28079190 missense possibly damaging 0.94
R6488:Fcnb UTSW 2 28078289 missense probably damaging 1.00
R8058:Fcnb UTSW 2 28079695 missense probably damaging 1.00
R8194:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8195:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8196:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8198:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8199:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8678:Fcnb UTSW 2 28078349 missense possibly damaging 0.61
R9224:Fcnb UTSW 2 28079148 missense probably damaging 1.00
X0024:Fcnb UTSW 2 28076691 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCTCTCTCACACAGGTTACC -3'
(R):5'- GTCCCTGTGTTCACTTCAGG -3'

Sequencing Primer
(F):5'- AGGTTACCTGTCAGCATTTCTG -3'
(R):5'- ACCTTCTCTGAGCATACCTGGG -3'
Posted On 2022-03-25