Incidental Mutation 'R0748:Flnc'
ID70223
Institutional Source Beutler Lab
Gene Symbol Flnc
Ensembl Gene ENSMUSG00000068699
Gene Namefilamin C, gamma
Synonyms1110055E19Rik, actin binding protein 280, Fln2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0748 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29433256-29461883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29446344 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 920 (E920G)
Ref Sequence ENSEMBL: ENSMUSP00000099139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065090] [ENSMUST00000101617]
Predicted Effect probably damaging
Transcript: ENSMUST00000065090
AA Change: E920G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064163
Gene: ENSMUSG00000068699
AA Change: E920G

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 1.05e-30 SMART
IG_FLMN 1777 1858 2.93e-11 SMART
IG_FLMN 1859 1950 2.55e-43 SMART
IG_FLMN 1951 2037 2.43e-17 SMART
IG_FLMN 2041 2132 1.52e-41 SMART
PDB:2E9I|A 2133 2162 3e-7 PDB
IG_FLMN 2217 2310 2.93e-11 SMART
IG_FLMN 2314 2405 1.67e-38 SMART
IG_FLMN 2408 2500 2.56e-25 SMART
IG_FLMN 2505 2596 9.54e-34 SMART
low complexity region 2618 2628 N/A INTRINSIC
IG_FLMN 2635 2737 2.11e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101617
AA Change: E920G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099139
Gene: ENSMUSG00000068699
AA Change: E920G

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 6.11e-32 SMART
IG_FLMN 1744 1825 2.93e-11 SMART
IG_FLMN 1826 1917 2.55e-43 SMART
IG_FLMN 1918 2004 2.43e-17 SMART
IG_FLMN 2008 2099 1.52e-41 SMART
PDB:2E9I|A 2100 2129 3e-7 PDB
IG_FLMN 2184 2277 2.93e-11 SMART
IG_FLMN 2281 2372 1.67e-38 SMART
IG_FLMN 2375 2467 2.56e-25 SMART
IG_FLMN 2472 2563 9.54e-34 SMART
low complexity region 2585 2595 N/A INTRINSIC
IG_FLMN 2602 2704 2.11e-26 SMART
Meta Mutation Damage Score 0.2002 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display neonatal lethality, respiratory failure, reduced skeletal muscle mass, and abnormal skeletal muscle fiber morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,876 V718A probably damaging Het
Amigo1 A G 3: 108,188,630 S482G probably damaging Het
F2rl3 A G 8: 72,762,751 Q202R probably benign Het
Faap100 A G 11: 120,372,171 V787A probably damaging Het
Fat4 A T 3: 38,887,828 Q290L possibly damaging Het
Gm9881 T C 16: 91,170,425 N137S unknown Het
Hps4 A G 5: 112,374,914 E546G probably damaging Het
Htr2b A G 1: 86,110,806 I26T probably benign Het
Insr A C 8: 3,258,841 M65R probably damaging Het
Kif20a T C 18: 34,628,188 probably benign Het
L3mbtl1 A T 2: 162,971,163 probably benign Het
L3mbtl1 A C 2: 162,971,164 probably null Het
Lcn4 T C 2: 26,668,347 I175M probably damaging Het
Malt1 T A 18: 65,475,260 probably null Het
Nufip1 T C 14: 76,111,068 S46P probably damaging Het
Nup93 T A 8: 94,307,943 Y629N probably damaging Het
Olfr517 C A 7: 108,869,150 M1I probably null Het
Pcsk6 T C 7: 66,038,968 probably benign Het
Rdx G C 9: 52,064,860 V33L possibly damaging Het
Rnf213 T C 11: 119,473,480 L4535P probably damaging Het
Rorb T A 19: 18,977,800 T66S probably damaging Het
S100a9 T C 3: 90,692,891 D66G possibly damaging Het
Sacs T C 14: 61,209,265 I2920T probably damaging Het
Safb2 T C 17: 56,575,580 N351S probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Unc13b G A 4: 43,241,164 probably benign Het
Vars A G 17: 34,998,012 S489P probably damaging Het
Wars2 A G 3: 99,216,572 K250E probably damaging Het
Zfp292 A G 4: 34,816,424 probably benign Het
Other mutations in Flnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Flnc APN 6 29459547 nonsense probably null
IGL01099:Flnc APN 6 29433618 missense probably damaging 0.99
IGL01656:Flnc APN 6 29443508 splice site probably benign
IGL01659:Flnc APN 6 29448671 missense probably damaging 0.98
IGL01780:Flnc APN 6 29438493 nonsense probably null
IGL01935:Flnc APN 6 29454280 missense probably damaging 1.00
IGL02039:Flnc APN 6 29450719 missense probably benign 0.05
IGL02119:Flnc APN 6 29447512 missense probably damaging 0.98
IGL02122:Flnc APN 6 29444336 missense possibly damaging 0.70
IGL02236:Flnc APN 6 29454376 missense probably damaging 1.00
IGL02350:Flnc APN 6 29438493 nonsense probably null
IGL02357:Flnc APN 6 29438493 nonsense probably null
IGL02428:Flnc APN 6 29451485 missense probably damaging 1.00
IGL02496:Flnc APN 6 29440685 missense probably damaging 0.98
IGL02516:Flnc APN 6 29450841 missense probably damaging 0.99
IGL02696:Flnc APN 6 29446698 missense probably damaging 0.98
IGL03165:Flnc APN 6 29449378 missense probably damaging 1.00
IGL03190:Flnc APN 6 29445637 splice site probably benign
I1329:Flnc UTSW 6 29451415 missense probably damaging 1.00
R0111:Flnc UTSW 6 29454340 missense probably damaging 0.99
R0665:Flnc UTSW 6 29455531 missense probably damaging 1.00
R0960:Flnc UTSW 6 29441512 missense probably damaging 1.00
R1328:Flnc UTSW 6 29438613 missense probably damaging 1.00
R1502:Flnc UTSW 6 29438694 missense probably benign 0.45
R1544:Flnc UTSW 6 29444080 missense probably benign 0.00
R1565:Flnc UTSW 6 29455171 missense probably damaging 1.00
R1640:Flnc UTSW 6 29433807 missense possibly damaging 0.78
R1691:Flnc UTSW 6 29441214 missense probably benign 0.09
R1818:Flnc UTSW 6 29457448 missense probably damaging 1.00
R1826:Flnc UTSW 6 29455185 missense probably damaging 0.99
R1851:Flnc UTSW 6 29443479 missense probably damaging 1.00
R1898:Flnc UTSW 6 29438666 nonsense probably null
R1905:Flnc UTSW 6 29459460 missense probably damaging 1.00
R1985:Flnc UTSW 6 29444416 splice site probably benign
R2016:Flnc UTSW 6 29443797 critical splice donor site probably null
R2017:Flnc UTSW 6 29443797 critical splice donor site probably null
R2020:Flnc UTSW 6 29444363 missense probably damaging 0.97
R2104:Flnc UTSW 6 29450735 critical splice donor site probably null
R2132:Flnc UTSW 6 29443676 missense probably damaging 1.00
R2141:Flnc UTSW 6 29448675 missense probably damaging 1.00
R2197:Flnc UTSW 6 29459135 missense probably damaging 1.00
R2202:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2203:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2204:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2205:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2209:Flnc UTSW 6 29455845 missense possibly damaging 0.91
R2248:Flnc UTSW 6 29451401 missense probably damaging 0.99
R2258:Flnc UTSW 6 29438666 nonsense probably null
R2259:Flnc UTSW 6 29438666 nonsense probably null
R2280:Flnc UTSW 6 29438666 nonsense probably null
R2281:Flnc UTSW 6 29438666 nonsense probably null
R2873:Flnc UTSW 6 29447543 missense probably damaging 0.96
R2900:Flnc UTSW 6 29448585 missense probably damaging 0.98
R3788:Flnc UTSW 6 29454057 missense probably damaging 0.99
R3799:Flnc UTSW 6 29443739 missense probably damaging 1.00
R3801:Flnc UTSW 6 29447404 missense probably damaging 0.98
R3851:Flnc UTSW 6 29453719 missense probably damaging 1.00
R3910:Flnc UTSW 6 29459427 missense probably damaging 1.00
R3982:Flnc UTSW 6 29442941 missense probably damaging 1.00
R3983:Flnc UTSW 6 29442941 missense probably damaging 1.00
R4023:Flnc UTSW 6 29451635 missense possibly damaging 0.95
R4676:Flnc UTSW 6 29445154 splice site probably null
R4694:Flnc UTSW 6 29443448 missense probably damaging 1.00
R4695:Flnc UTSW 6 29440429 missense probably damaging 0.99
R4735:Flnc UTSW 6 29455813 missense probably damaging 1.00
R4773:Flnc UTSW 6 29445039 missense possibly damaging 0.96
R4828:Flnc UTSW 6 29455167 missense probably damaging 1.00
R4856:Flnc UTSW 6 29447890 missense probably damaging 1.00
R4879:Flnc UTSW 6 29460806 missense probably damaging 0.99
R4899:Flnc UTSW 6 29446843 missense probably benign 0.17
R4906:Flnc UTSW 6 29447525 missense probably damaging 0.99
R5089:Flnc UTSW 6 29447813 missense probably damaging 0.96
R5173:Flnc UTSW 6 29455538 missense probably damaging 1.00
R5174:Flnc UTSW 6 29448894 missense possibly damaging 0.91
R5290:Flnc UTSW 6 29457554 missense probably damaging 1.00
R5338:Flnc UTSW 6 29444064 missense possibly damaging 0.47
R5352:Flnc UTSW 6 29449318 missense possibly damaging 0.85
R5397:Flnc UTSW 6 29441161 missense possibly damaging 0.87
R5431:Flnc UTSW 6 29456384 missense possibly damaging 0.74
R5481:Flnc UTSW 6 29441217 missense probably damaging 1.00
R5511:Flnc UTSW 6 29458898 missense probably damaging 1.00
R5539:Flnc UTSW 6 29446230 missense probably damaging 1.00
R5549:Flnc UTSW 6 29453691 missense probably damaging 1.00
R5567:Flnc UTSW 6 29444045 nonsense probably null
R5584:Flnc UTSW 6 29446628 missense probably damaging 0.98
R5689:Flnc UTSW 6 29441592 missense probably benign 0.03
R5753:Flnc UTSW 6 29433489 missense probably benign
R5786:Flnc UTSW 6 29459537 nonsense probably null
R5822:Flnc UTSW 6 29459430 missense probably damaging 0.98
R5823:Flnc UTSW 6 29461202 missense probably damaging 0.99
R5933:Flnc UTSW 6 29441106 missense probably damaging 0.99
R6043:Flnc UTSW 6 29446608 missense probably damaging 1.00
R6320:Flnc UTSW 6 29459063 missense probably damaging 1.00
R6337:Flnc UTSW 6 29454319 missense probably damaging 0.99
R6399:Flnc UTSW 6 29458883 missense probably damaging 1.00
R6423:Flnc UTSW 6 29445156 splice site probably null
R6540:Flnc UTSW 6 29446377 missense possibly damaging 0.96
R6547:Flnc UTSW 6 29448608 missense probably damaging 0.98
R6717:Flnc UTSW 6 29450902 small deletion probably benign
R6875:Flnc UTSW 6 29445749 missense probably damaging 1.00
R7193:Flnc UTSW 6 29450871 missense probably damaging 1.00
R7255:Flnc UTSW 6 29445766 missense probably damaging 1.00
R7303:Flnc UTSW 6 29460850 missense probably benign 0.31
R7413:Flnc UTSW 6 29452259 missense probably damaging 1.00
R7422:Flnc UTSW 6 29455471 missense probably damaging 1.00
R7559:Flnc UTSW 6 29459010 missense probably damaging 1.00
R7632:Flnc UTSW 6 29446985 missense probably damaging 0.98
R7651:Flnc UTSW 6 29444050 missense probably benign 0.08
R7679:Flnc UTSW 6 29456790 missense probably benign 0.00
R7697:Flnc UTSW 6 29456517 missense probably damaging 0.98
R7788:Flnc UTSW 6 29456444 missense possibly damaging 0.67
Z1088:Flnc UTSW 6 29457151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAAGGTGGACCCATCCCATGAC -3'
(R):5'- ACCACAAAGGGACTTTTGGGGAC -3'

Sequencing Primer
(F):5'- CTGAGCCGCACAGGTAGATG -3'
(R):5'- CCATGTTGCCCTATTGGGTAAAAG -3'
Posted On2013-09-30