Incidental Mutation 'R9261:Clca3a2'
ID 702230
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R9261 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144796559-144819494 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 144819397 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 25 (H25N)
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000159989]
AlphaFold Q9EQR4
Predicted Effect probably benign
Transcript: ENSMUST00000029929
AA Change: H25N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262
AA Change: H25N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159989
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,698 H52L probably benign Het
Adamts7 A G 9: 90,193,344 E1043G probably benign Het
Agps T G 2: 75,854,506 probably benign Het
Ahnak A G 19: 9,016,139 E4929G possibly damaging Het
Arl6ip4 T A 5: 124,118,083 probably benign Het
Cubn C T 2: 13,278,451 D3559N probably damaging Het
Dmac2 T A 7: 25,620,920 W15R probably benign Het
Dzank1 T C 2: 144,513,424 E117G probably benign Het
Eml2 A G 7: 19,179,818 T187A probably benign Het
Eml5 A G 12: 98,856,028 V747A probably damaging Het
Esr1 T A 10: 4,969,271 S454T probably damaging Het
Evc2 A G 5: 37,380,551 T528A probably benign Het
Fbxo5 T C 10: 5,802,325 N96S probably damaging Het
Fcnb T C 2: 28,079,624 T144A probably damaging Het
Fgf20 T A 8: 40,286,910 probably benign Het
Gcg T C 2: 62,476,064 probably benign Het
Gfm2 T A 13: 97,162,861 Y363* probably null Het
Gm28710 T C 5: 16,801,549 L88P possibly damaging Het
Gm4951 T A 18: 60,220,748 probably benign Het
Grwd1 C T 7: 45,825,957 R387Q probably benign Het
Gstt2 C T 10: 75,833,677 D59N possibly damaging Het
Herc1 A G 9: 66,504,847 N4783S probably damaging Het
Hydin C A 8: 110,267,415 A27E unknown Het
Ikbip A G 10: 91,096,387 T298A possibly damaging Het
Il1rap A G 16: 26,722,974 N655S possibly damaging Het
Kif21b C T 1: 136,149,424 R395C probably damaging Het
Kif3a ATTGACG A 11: 53,593,421 probably benign Het
Klhl40 A G 9: 121,779,936 D389G probably benign Het
Ly6g A G 15: 75,158,680 T116A probably damaging Het
Mast2 A G 4: 116,308,703 L1276P probably damaging Het
Mitf A G 6: 98,013,743 Q369R possibly damaging Het
Mtus2 T A 5: 148,306,643 Y192* probably null Het
Nav1 T A 1: 135,460,357 E1109D unknown Het
Nav2 A G 7: 49,597,156 E2143G probably damaging Het
Nedd4 A G 9: 72,677,374 Q119R possibly damaging Het
Nek9 A G 12: 85,313,067 V537A probably damaging Het
Notum G T 11: 120,660,148 T64K Het
Nudcd2 A G 11: 40,739,199 N144S probably damaging Het
Nup205 A G 6: 35,199,857 E596G probably benign Het
Olfml1 T A 7: 107,567,800 L12Q possibly damaging Het
Olfr1313 T A 2: 112,072,373 D70V probably damaging Het
Olfr524 A G 7: 140,202,650 V40A probably benign Het
Olfr639 C T 7: 104,012,129 C191Y probably damaging Het
Olfr661 T A 7: 104,688,053 F13I probably benign Het
Olfr668 A T 7: 104,925,098 M222K probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Padi4 T C 4: 140,752,615 N409S probably damaging Het
Pam T A 1: 97,975,895 T38S probably benign Het
Piezo2 T C 18: 63,075,797 I1382V possibly damaging Het
Pla2g12a A T 3: 129,890,431 Q153L possibly damaging Het
Pla2g4e T A 2: 120,189,429 H180L probably benign Het
Pprc1 A G 19: 46,062,429 T169A unknown Het
Prrc2c A G 1: 162,678,053 I2592T possibly damaging Het
Ptchd3 T A 11: 121,832,130 I348N probably damaging Het
Ralgps1 T C 2: 33,336,559 D40G probably damaging Het
Rbm19 T C 5: 120,118,745 F41S probably damaging Het
Rbsn T C 6: 92,189,816 M616V probably benign Het
Ryr1 A T 7: 29,052,388 M3660K possibly damaging Het
Sidt2 A T 9: 45,950,098 V246E probably damaging Het
Slc4a4 T C 5: 89,199,709 W770R probably damaging Het
Spata31d1c T A 13: 65,036,866 S741T probably damaging Het
Stk19 T G 17: 34,832,456 Y108S possibly damaging Het
Stox2 T C 8: 47,192,406 E673G possibly damaging Het
Tax1bp1 T A 6: 52,737,131 C271S probably benign Het
Tmem161a C A 8: 70,178,922 R167S probably damaging Het
Tnrc6c T A 11: 117,714,279 V80E probably damaging Het
Trpa1 G A 1: 14,893,241 H586Y probably damaging Het
Tsr1 A G 11: 74,908,230 T746A probably damaging Het
Uqcrfs1 T C 13: 30,540,811 I249V probably damaging Het
Vmn2r84 C A 10: 130,394,107 E45D probably benign Het
Vnn3 A G 10: 23,865,709 E304G probably damaging Het
Zfp541 G A 7: 16,082,104 V839M possibly damaging Het
Zfp62 A G 11: 49,217,523 K814E probably benign Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 splice site probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
R7889:Clca3a2 UTSW 3 144810813 nonsense probably null
R7946:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144813995 missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144805766 missense probably damaging 1.00
R8344:Clca3a2 UTSW 3 144805942 critical splice acceptor site probably null
R8367:Clca3a2 UTSW 3 144817747 splice site probably null
R8371:Clca3a2 UTSW 3 144807353 nonsense probably null
R8814:Clca3a2 UTSW 3 144797764 missense probably benign 0.18
R9031:Clca3a2 UTSW 3 144805714 missense probably damaging 1.00
R9069:Clca3a2 UTSW 3 144813686 splice site probably benign
R9201:Clca3a2 UTSW 3 144813923 missense probably benign 0.00
R9469:Clca3a2 UTSW 3 144802177 missense probably damaging 1.00
R9515:Clca3a2 UTSW 3 144803047 nonsense probably null
R9569:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R9664:Clca3a2 UTSW 3 144797814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAGACGGTCAAAGCGCC -3'
(R):5'- GTCCCAAGAGATATCAGCATTTC -3'

Sequencing Primer
(F):5'- AAAACCGTGTGTGTGAGTGTGTAAC -3'
(R):5'- GCAAATATTCTGGCCGTG -3'
Posted On 2022-03-25