Incidental Mutation 'R9261:Mitf'
ID 702241
Institutional Source Beutler Lab
Gene Symbol Mitf
Ensembl Gene ENSMUSG00000035158
Gene Name melanogenesis associated transcription factor
Synonyms wh, mi, Gsfbcc2, bHLHe32, BCC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock # R9261 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 97807052-98021349 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98013743 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 369 (Q369R)
Ref Sequence ENSEMBL: ENSMUSP00000044938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043628] [ENSMUST00000043637] [ENSMUST00000101123] [ENSMUST00000113339] [ENSMUST00000139462] [ENSMUST00000203884] [ENSMUST00000203938]
AlphaFold Q08874
Predicted Effect possibly damaging
Transcript: ENSMUST00000043628
AA Change: Q262R

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044459
Gene: ENSMUSG00000035158
AA Change: Q262R

DomainStartEndE-ValueType
HLH 210 263 5.53e-17 SMART
Pfam:DUF3371 290 416 9.5e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000043637
AA Change: Q369R

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044938
Gene: ENSMUSG00000035158
AA Change: Q369R

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:MITF_TFEB_C_3_N 56 228 3.1e-52 PFAM
HLH 317 370 5.53e-17 SMART
Pfam:DUF3371 397 522 2.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101123
AA Change: Q353R

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098683
Gene: ENSMUSG00000035158
AA Change: Q353R

DomainStartEndE-ValueType
coiled coil region 44 74 N/A INTRINSIC
HLH 301 354 5.53e-17 SMART
Pfam:DUF3371 381 507 4.8e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113339
AA Change: Q344R

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108965
Gene: ENSMUSG00000035158
AA Change: Q344R

DomainStartEndE-ValueType
coiled coil region 35 65 N/A INTRINSIC
HLH 292 345 5.53e-17 SMART
Pfam:DUF3371 372 498 4.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139462
Predicted Effect probably damaging
Transcript: ENSMUST00000203884
AA Change: Q363R

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145132
Gene: ENSMUSG00000035158
AA Change: Q363R

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:MITF_TFEB_C_3_N 56 228 2.2e-49 PFAM
HLH 311 364 2.3e-19 SMART
Pfam:DUF3371 391 516 1.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203938
AA Change: Q200R

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144988
Gene: ENSMUSG00000035158
AA Change: Q200R

DomainStartEndE-ValueType
Pfam:MITF_TFEB_C_3_N 7 60 2.2e-7 PFAM
HLH 148 201 2.3e-19 SMART
Pfam:DUF3371 228 353 9.2e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: This transcription factor serves at a critical point between extracellular signaling and downstream targets in cell specification in early eye and neural crest development. Mutant alleles have been identified that generate distinct phenotypes. Some of these alleles are being used to model the human diseases Waardenburg syndrome IIa and Tietz syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect development of melanocytes, mast cells, osteoclasts and pigmented epithelium. Mutants variably display lack of pigment in coat and eye, microphthalmia, hearing loss, bone resorption anomalies, mast cell deficiency and lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,698 H52L probably benign Het
Adamts7 A G 9: 90,193,344 E1043G probably benign Het
Agps T G 2: 75,854,506 probably benign Het
Ahnak A G 19: 9,016,139 E4929G possibly damaging Het
Arl6ip4 T A 5: 124,118,083 probably benign Het
Clca3a2 G T 3: 144,819,397 H25N probably benign Het
Cubn C T 2: 13,278,451 D3559N probably damaging Het
Dmac2 T A 7: 25,620,920 W15R probably benign Het
Dzank1 T C 2: 144,513,424 E117G probably benign Het
Eml2 A G 7: 19,179,818 T187A probably benign Het
Eml5 A G 12: 98,856,028 V747A probably damaging Het
Esr1 T A 10: 4,969,271 S454T probably damaging Het
Evc2 A G 5: 37,380,551 T528A probably benign Het
Fbxo5 T C 10: 5,802,325 N96S probably damaging Het
Fcnb T C 2: 28,079,624 T144A probably damaging Het
Fgf20 T A 8: 40,286,910 probably benign Het
Gcg T C 2: 62,476,064 probably benign Het
Gfm2 T A 13: 97,162,861 Y363* probably null Het
Gm28710 T C 5: 16,801,549 L88P possibly damaging Het
Gm4951 T A 18: 60,220,748 probably benign Het
Grwd1 C T 7: 45,825,957 R387Q probably benign Het
Gstt2 C T 10: 75,833,677 D59N possibly damaging Het
Herc1 A G 9: 66,504,847 N4783S probably damaging Het
Hydin C A 8: 110,267,415 A27E unknown Het
Ikbip A G 10: 91,096,387 T298A possibly damaging Het
Il1rap A G 16: 26,722,974 N655S possibly damaging Het
Kif21b C T 1: 136,149,424 R395C probably damaging Het
Kif3a ATTGACG A 11: 53,593,421 probably benign Het
Klhl40 A G 9: 121,779,936 D389G probably benign Het
Ly6g A G 15: 75,158,680 T116A probably damaging Het
Mast2 A G 4: 116,308,703 L1276P probably damaging Het
Mtus2 T A 5: 148,306,643 Y192* probably null Het
Nav1 T A 1: 135,460,357 E1109D unknown Het
Nav2 A G 7: 49,597,156 E2143G probably damaging Het
Nedd4 A G 9: 72,677,374 Q119R possibly damaging Het
Nek9 A G 12: 85,313,067 V537A probably damaging Het
Notum G T 11: 120,660,148 T64K Het
Nudcd2 A G 11: 40,739,199 N144S probably damaging Het
Nup205 A G 6: 35,199,857 E596G probably benign Het
Olfml1 T A 7: 107,567,800 L12Q possibly damaging Het
Olfr1313 T A 2: 112,072,373 D70V probably damaging Het
Olfr524 A G 7: 140,202,650 V40A probably benign Het
Olfr639 C T 7: 104,012,129 C191Y probably damaging Het
Olfr661 T A 7: 104,688,053 F13I probably benign Het
Olfr668 A T 7: 104,925,098 M222K probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Padi4 T C 4: 140,752,615 N409S probably damaging Het
Pam T A 1: 97,975,895 T38S probably benign Het
Piezo2 T C 18: 63,075,797 I1382V possibly damaging Het
Pla2g12a A T 3: 129,890,431 Q153L possibly damaging Het
Pla2g4e T A 2: 120,189,429 H180L probably benign Het
Pprc1 A G 19: 46,062,429 T169A unknown Het
Prrc2c A G 1: 162,678,053 I2592T possibly damaging Het
Ptchd3 T A 11: 121,832,130 I348N probably damaging Het
Ralgps1 T C 2: 33,336,559 D40G probably damaging Het
Rbm19 T C 5: 120,118,745 F41S probably damaging Het
Rbsn T C 6: 92,189,816 M616V probably benign Het
Ryr1 A T 7: 29,052,388 M3660K possibly damaging Het
Sidt2 A T 9: 45,950,098 V246E probably damaging Het
Slc4a4 T C 5: 89,199,709 W770R probably damaging Het
Spata31d1c T A 13: 65,036,866 S741T probably damaging Het
Stk19 T G 17: 34,832,456 Y108S possibly damaging Het
Stox2 T C 8: 47,192,406 E673G possibly damaging Het
Tax1bp1 T A 6: 52,737,131 C271S probably benign Het
Tmem161a C A 8: 70,178,922 R167S probably damaging Het
Tnrc6c T A 11: 117,714,279 V80E probably damaging Het
Trpa1 G A 1: 14,893,241 H586Y probably damaging Het
Tsr1 A G 11: 74,908,230 T746A probably damaging Het
Uqcrfs1 T C 13: 30,540,811 I249V probably damaging Het
Vmn2r84 C A 10: 130,394,107 E45D probably benign Het
Vnn3 A G 10: 23,865,709 E304G probably damaging Het
Zfp541 G A 7: 16,082,104 V839M possibly damaging Het
Zfp62 A G 11: 49,217,523 K814E probably benign Het
Other mutations in Mitf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Mitf APN 6 98017931 missense possibly damaging 0.69
IGL01516:Mitf APN 6 98010390 splice site probably null
IGL01617:Mitf APN 6 97996428 missense probably benign 0.00
IGL01875:Mitf APN 6 98017895 missense probably benign 0.22
R0010:Mitf UTSW 6 97807281 missense probably benign 0.25
R0010:Mitf UTSW 6 97807281 missense probably benign 0.25
R0079:Mitf UTSW 6 97996440 missense probably benign 0.00
R0381:Mitf UTSW 6 97993143 missense probably damaging 1.00
R0494:Mitf UTSW 6 97994429 missense probably benign 0.00
R0633:Mitf UTSW 6 98003904 missense probably damaging 0.98
R0829:Mitf UTSW 6 98003908 missense possibly damaging 0.46
R1189:Mitf UTSW 6 98006125 missense possibly damaging 0.67
R1459:Mitf UTSW 6 98010467 missense probably damaging 1.00
R1766:Mitf UTSW 6 97941099 missense probably damaging 1.00
R1864:Mitf UTSW 6 98010422 missense probably damaging 1.00
R1891:Mitf UTSW 6 97941276 missense probably benign 0.00
R3934:Mitf UTSW 6 97993253 missense probably damaging 1.00
R3936:Mitf UTSW 6 97993253 missense probably damaging 1.00
R4323:Mitf UTSW 6 97991949 missense probably benign 0.12
R5052:Mitf UTSW 6 98010445 missense possibly damaging 0.91
R5097:Mitf UTSW 6 97996462 missense possibly damaging 0.63
R5297:Mitf UTSW 6 97994430 missense probably benign 0.09
R5646:Mitf UTSW 6 98013694 missense probably damaging 1.00
R6109:Mitf UTSW 6 97996468 missense probably damaging 1.00
R6351:Mitf UTSW 6 98003912 missense possibly damaging 0.85
R6411:Mitf UTSW 6 98010472 critical splice donor site probably null
R7855:Mitf UTSW 6 97993196 missense probably damaging 1.00
R7904:Mitf UTSW 6 98013710 missense probably damaging 0.99
R7975:Mitf UTSW 6 98018029 missense probably benign 0.17
R8061:Mitf UTSW 6 97993298 missense probably damaging 0.98
R9135:Mitf UTSW 6 98013719 missense probably damaging 1.00
R9187:Mitf UTSW 6 98017874 missense probably benign 0.05
R9795:Mitf UTSW 6 97993182 missense probably benign
Z1177:Mitf UTSW 6 98006121 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGCACTAATTGGGATCTAGC -3'
(R):5'- GGCAAACTCACAATTATGGGACC -3'

Sequencing Primer
(F):5'- GCACTAATTGGGATCTAGCCATCAC -3'
(R):5'- TCACAATTATGGGACCAACAAACAG -3'
Posted On 2022-03-25