Incidental Mutation 'R9261:Eml2'
ID 702243
Institutional Source Beutler Lab
Gene Symbol Eml2
Ensembl Gene ENSMUSG00000040811
Gene Name echinoderm microtubule associated protein like 2
Synonyms 1600029N02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9261 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 19176421-19206482 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19179818 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 187 (T187A)
Ref Sequence ENSEMBL: ENSMUSP00000112491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000141718] [ENSMUST00000144054] [ENSMUST00000148246]
AlphaFold Q7TNG5
Predicted Effect probably benign
Transcript: ENSMUST00000048502
SMART Domains Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
Pfam:HELP 17 65 4.6e-14 PFAM
WD40 113 162 8.36e-2 SMART
WD40 165 210 9.21e0 SMART
WD40 213 252 7.99e-1 SMART
WD40 258 298 3.7e0 SMART
WD40 301 341 3.58e-1 SMART
WD40 385 424 5.52e-2 SMART
WD40 427 465 1.1e1 SMART
WD40 468 507 4.95e-4 SMART
WD40 514 553 4.62e-4 SMART
WD40 579 620 4.75e1 SMART
WD40 626 666 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117338
AA Change: T187A

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: T187A

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120595
SMART Domains Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
WD40 94 154 2.48e0 SMART
WD40 157 196 7.99e-1 SMART
WD40 202 242 3.7e0 SMART
WD40 245 285 3.58e-1 SMART
WD40 329 368 5.52e-2 SMART
WD40 371 409 1.1e1 SMART
WD40 412 451 4.95e-4 SMART
WD40 458 497 4.62e-4 SMART
WD40 523 564 4.75e1 SMART
WD40 570 610 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141718
Predicted Effect probably benign
Transcript: ENSMUST00000144054
Predicted Effect probably benign
Transcript: ENSMUST00000148246
SMART Domains Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
WD40 94 143 8.36e-2 SMART
WD40 146 191 9.21e0 SMART
WD40 194 233 7.99e-1 SMART
WD40 239 279 3.7e0 SMART
WD40 282 322 3.58e-1 SMART
WD40 366 405 5.52e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,698 H52L probably benign Het
Adamts7 A G 9: 90,193,344 E1043G probably benign Het
Ahnak A G 19: 9,016,139 E4929G possibly damaging Het
Clca3a2 G T 3: 144,819,397 H25N probably benign Het
Cubn C T 2: 13,278,451 D3559N probably damaging Het
Dmac2 T A 7: 25,620,920 W15R probably benign Het
Dzank1 T C 2: 144,513,424 E117G probably benign Het
Eml5 A G 12: 98,856,028 V747A probably damaging Het
Esr1 T A 10: 4,969,271 S454T probably damaging Het
Evc2 A G 5: 37,380,551 T528A probably benign Het
Fbxo5 T C 10: 5,802,325 N96S probably damaging Het
Fcnb T C 2: 28,079,624 T144A probably damaging Het
Gfm2 T A 13: 97,162,861 Y363* probably null Het
Gm28710 T C 5: 16,801,549 L88P possibly damaging Het
Grwd1 C T 7: 45,825,957 R387Q probably benign Het
Gstt2 C T 10: 75,833,677 D59N possibly damaging Het
Herc1 A G 9: 66,504,847 N4783S probably damaging Het
Hydin C A 8: 110,267,415 A27E unknown Het
Ikbip A G 10: 91,096,387 T298A possibly damaging Het
Il1rap A G 16: 26,722,974 N655S possibly damaging Het
Kif21b C T 1: 136,149,424 R395C probably damaging Het
Kif3a ATTGACG A 11: 53,593,421 probably benign Het
Klhl40 A G 9: 121,779,936 D389G probably benign Het
Ly6g A G 15: 75,158,680 T116A probably damaging Het
Mast2 A G 4: 116,308,703 L1276P probably damaging Het
Mitf A G 6: 98,013,743 Q369R possibly damaging Het
Mtus2 T A 5: 148,306,643 Y192* probably null Het
Nav1 T A 1: 135,460,357 E1109D unknown Het
Nav2 A G 7: 49,597,156 E2143G probably damaging Het
Nedd4 A G 9: 72,677,374 Q119R possibly damaging Het
Nek9 A G 12: 85,313,067 V537A probably damaging Het
Notum G T 11: 120,660,148 T64K probably damaging Het
Nudcd2 A G 11: 40,739,199 N144S probably damaging Het
Nup205 A G 6: 35,199,857 E596G probably benign Het
Olfml1 T A 7: 107,567,800 L12Q possibly damaging Het
Olfr1313 T A 2: 112,072,373 D70V probably damaging Het
Olfr524 A G 7: 140,202,650 V40A probably benign Het
Olfr639 C T 7: 104,012,129 C191Y probably damaging Het
Olfr661 T A 7: 104,688,053 F13I probably benign Het
Olfr668 A T 7: 104,925,098 M222K probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Padi4 T C 4: 140,752,615 N409S probably damaging Het
Pam T A 1: 97,975,895 T38S probably benign Het
Piezo2 T C 18: 63,075,797 I1382V possibly damaging Het
Pla2g12a A T 3: 129,890,431 Q153L possibly damaging Het
Pla2g4e T A 2: 120,189,429 H180L probably benign Het
Pprc1 A G 19: 46,062,429 T169A unknown Het
Prrc2c A G 1: 162,678,053 I2592T possibly damaging Het
Ptchd3 T A 11: 121,832,130 I348N probably damaging Het
Ralgps1 T C 2: 33,336,559 D40G probably damaging Het
Rbm19 T C 5: 120,118,745 F41S probably damaging Het
Rbsn T C 6: 92,189,816 M616V probably benign Het
Ryr1 A T 7: 29,052,388 M3660K possibly damaging Het
Sidt2 A T 9: 45,950,098 V246E probably damaging Het
Slc4a4 T C 5: 89,199,709 W770R probably damaging Het
Spata31d1c T A 13: 65,036,866 S741T probably damaging Het
Stk19 T G 17: 34,832,456 Y108S possibly damaging Het
Stox2 T C 8: 47,192,406 E673G possibly damaging Het
Tax1bp1 T A 6: 52,737,131 C271S probably benign Het
Tmem161a C A 8: 70,178,922 R167S probably damaging Het
Tnrc6c T A 11: 117,714,279 V80E probably damaging Het
Trpa1 G A 1: 14,893,241 H586Y probably damaging Het
Tsr1 A G 11: 74,908,230 T746A probably damaging Het
Uqcrfs1 T C 13: 30,540,811 I249V probably damaging Het
Vmn2r84 C A 10: 130,394,107 E45D probably benign Het
Vnn3 A G 10: 23,865,709 E304G probably damaging Het
Zfp541 G A 7: 16,082,104 V839M possibly damaging Het
Zfp62 A G 11: 49,217,523 K814E probably benign Het
Other mutations in Eml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Eml2 APN 7 19206143 missense probably damaging 1.00
IGL00786:Eml2 APN 7 19202582 missense probably damaging 1.00
IGL01084:Eml2 APN 7 19190738 nonsense probably null
IGL01132:Eml2 APN 7 19200539 missense probably damaging 1.00
IGL01678:Eml2 APN 7 19186122 missense probably benign 0.38
IGL01800:Eml2 APN 7 19201197 intron probably benign
IGL02517:Eml2 APN 7 19206130 missense probably damaging 1.00
IGL02607:Eml2 APN 7 19206111 missense probably damaging 1.00
IGL02676:Eml2 APN 7 19184921 nonsense probably null
IGL03082:Eml2 APN 7 19201877 missense probably damaging 1.00
puffery UTSW 7 19201163 missense probably damaging 1.00
R0628_Eml2_697 UTSW 7 19201554 splice site probably benign
R0040:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R0135:Eml2 UTSW 7 19203952 missense probably damaging 1.00
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0362:Eml2 UTSW 7 19190806 splice site probably null
R0387:Eml2 UTSW 7 19182259 splice site probably null
R0432:Eml2 UTSW 7 19179531 nonsense probably null
R0614:Eml2 UTSW 7 19202591 missense probably damaging 1.00
R0628:Eml2 UTSW 7 19201554 splice site probably benign
R1078:Eml2 UTSW 7 19179762 missense probably benign 0.24
R1531:Eml2 UTSW 7 19196254 missense probably damaging 1.00
R1856:Eml2 UTSW 7 19194061 missense probably damaging 0.97
R1864:Eml2 UTSW 7 19201878 missense probably damaging 1.00
R1937:Eml2 UTSW 7 19203964 missense possibly damaging 0.68
R2032:Eml2 UTSW 7 19202555 missense probably benign 0.03
R2185:Eml2 UTSW 7 19194028 missense probably damaging 1.00
R2419:Eml2 UTSW 7 19176695 unclassified probably benign
R3821:Eml2 UTSW 7 19202986 missense possibly damaging 0.94
R4199:Eml2 UTSW 7 19179439 missense probably benign 0.00
R4411:Eml2 UTSW 7 19182401 critical splice donor site probably null
R4497:Eml2 UTSW 7 19179350 missense probably damaging 1.00
R4885:Eml2 UTSW 7 19204010 missense probably benign 0.05
R4912:Eml2 UTSW 7 19193999 splice site probably null
R5028:Eml2 UTSW 7 19179447 critical splice donor site probably null
R5192:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5196:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5373:Eml2 UTSW 7 19179263 missense possibly damaging 0.92
R5718:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5719:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5720:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5727:Eml2 UTSW 7 19190760 missense probably damaging 0.99
R5841:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5842:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5843:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5844:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6014:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6015:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6017:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6073:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6075:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6126:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6128:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6129:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6189:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6190:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6258:Eml2 UTSW 7 19179364 splice site probably null
R6273:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6289:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6376:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6378:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6381:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6384:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6394:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6435:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6436:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6437:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6476:Eml2 UTSW 7 19196311 missense probably benign 0.26
R6550:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6551:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6552:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6554:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6572:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R6598:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6599:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6704:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6705:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6709:Eml2 UTSW 7 19206211 makesense probably null
R6730:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6734:Eml2 UTSW 7 19200507 missense probably benign 0.35
R6742:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6769:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6770:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6864:Eml2 UTSW 7 19196281 missense probably damaging 0.99
R6878:Eml2 UTSW 7 19200612 missense probably benign 0.08
R7045:Eml2 UTSW 7 19201579 missense probably damaging 1.00
R7260:Eml2 UTSW 7 19200590 missense probably benign 0.45
R7478:Eml2 UTSW 7 19206141 nonsense probably null
R7706:Eml2 UTSW 7 19186110 missense possibly damaging 0.79
R7811:Eml2 UTSW 7 19186122 missense probably benign 0.38
R8084:Eml2 UTSW 7 19181224 critical splice donor site probably null
R8337:Eml2 UTSW 7 19196236 missense possibly damaging 0.84
R8414:Eml2 UTSW 7 19179295 missense probably damaging 1.00
R8868:Eml2 UTSW 7 19194063 missense probably benign 0.03
R8934:Eml2 UTSW 7 19179813 missense probably damaging 0.99
R9110:Eml2 UTSW 7 19191695 missense probably benign 0.07
R9131:Eml2 UTSW 7 19184826 missense
R9144:Eml2 UTSW 7 19201639 missense possibly damaging 0.75
R9285:Eml2 UTSW 7 19191643 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGTCAGCTCCTGAAAGGC -3'
(R):5'- ACAGAGACTCTTGACTGTTGTG -3'

Sequencing Primer
(F):5'- AGCTCCTGAAAGGCCTTCC -3'
(R):5'- GTTGTGTTCTGACTCCACCAG -3'
Posted On 2022-03-25