Mutagenetix > Incidental Mutation

Incidental Mutation 'R0748:Pcsk6'

70225

Institutional Source

Beutler Lab

Gene Symbol

Pcsk6

Ensembl Gene

ENSMUSG00000030513

Gene Name

proprotein convertase subtilisin/kexin type 6

Synonyms

PACE4, SPC4

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.450) question?

Stock #

R0748 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65861734-66050386 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 66038968 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055576] [ENSMUST00000098391] [ENSMUST00000176209]

AlphaFold

F6XJP7

Predicted Effect

probably benign
Transcript: ENSMUST00000055576

SMART Domains

Protein: ENSMUSP00000053742
Gene: ENSMUSG00000030513

Domain	Start	End	E-Value	Type
signal peptide	1	54	N/A	INTRINSIC
Pfam:S8_pro-domain	65	141	3.1e-29	PFAM
Pfam:Peptidase_S8	186	469	5.2e-49	PFAM
Pfam:P_proprotein	529	619	9.7e-37	PFAM
FU	682	729	5.87e-11	SMART
EGF_like	688	737	5.03e1	SMART
FU	733	780	4.35e-14	SMART
EGF_like	738	771	3.57e1	SMART
FU	784	828	2.08e-11	SMART
EGF	789	819	2.48e1	SMART
FU	832	877	9.4e-10	SMART
EGF_like	837	868	6.28e1	SMART
FU	885	933	8.58e-4	SMART
EGF	890	920	1.69e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000098391

SMART Domains

Protein: ENSMUSP00000095992
Gene: ENSMUSG00000030513

Domain	Start	End	E-Value	Type
signal peptide	1	54	N/A	INTRINSIC
PDB:1KN6\|A	62	129	2e-6	PDB
low complexity region	131	144	N/A	INTRINSIC
Pfam:Peptidase_S8	190	478	1.1e-58	PFAM
Pfam:P_proprotein	529	619	4.5e-37	PFAM
FU	669	716	3.87e-11	SMART
EGF_like	675	724	5.03e1	SMART
FU	720	767	4.35e-14	SMART
EGF_like	725	758	3.57e1	SMART
FU	771	815	2.08e-11	SMART
EGF	776	806	2.48e1	SMART
FU	819	864	9.4e-10	SMART
EGF_like	824	855	6.28e1	SMART
FU	872	920	8.58e-4	SMART
EGF	877	907	1.69e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176209

SMART Domains

Protein: ENSMUSP00000135033
Gene: ENSMUSG00000030513

Domain	Start	End	E-Value	Type
low complexity region	44	57	N/A	INTRINSIC
Pfam:Peptidase_S8	103	372	6.5e-50	PFAM
Pfam:P_proprotein	368	458	6.2e-37	PFAM
FU	521	568	5.87e-11	SMART
EGF_like	527	576	5.03e1	SMART
FU	572	619	4.35e-14	SMART
EGF_like	577	610	3.57e1	SMART
FU	623	667	2.08e-11	SMART
EGF	628	658	2.48e1	SMART
FU	671	716	9.4e-10	SMART
EGF_like	676	707	6.28e1	SMART
FU	724	772	8.58e-4	SMART
EGF	729	759	1.69e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177272

Predicted Effect

probably benign
Transcript: ENSMUST00000206065

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 92.4%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality by E15.5. Embryos develop situs ambiguus with left pulmonary isomerism or craniofacial malformations including cyclopia, or both. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf3	A	G	5: 30,196,876	V718A	probably damaging	Het
Amigo1	A	G	3: 108,188,630	S482G	probably damaging	Het
F2rl3	A	G	8: 72,762,751	Q202R	probably benign	Het
Faap100	A	G	11: 120,372,171	V787A	probably damaging	Het
Fat4	A	T	3: 38,887,828	Q290L	possibly damaging	Het
Flnc	A	G	6: 29,446,344	E920G	probably damaging	Het
Gm9881	T	C	16: 91,170,425	N137S	unknown	Het
Hps4	A	G	5: 112,374,914	E546G	probably damaging	Het
Htr2b	A	G	1: 86,110,806	I26T	probably benign	Het
Insr	A	C	8: 3,258,841	M65R	probably damaging	Het
Kif20a	T	C	18: 34,628,188		probably benign	Het
L3mbtl1	A	T	2: 162,971,163		probably benign	Het
L3mbtl1	A	C	2: 162,971,164		probably null	Het
Lcn4	T	C	2: 26,668,347	I175M	probably damaging	Het
Malt1	T	A	18: 65,475,260		probably null	Het
Nufip1	T	C	14: 76,111,068	S46P	probably damaging	Het
Nup93	T	A	8: 94,307,943	Y629N	probably damaging	Het
Olfr517	C	A	7: 108,869,150	M1I	probably null	Het
Rdx	G	C	9: 52,064,860	V33L	possibly damaging	Het
Rnf213	T	C	11: 119,473,480	L4535P	probably damaging	Het
Rorb	T	A	19: 18,977,800	T66S	probably damaging	Het
S100a9	T	C	3: 90,692,891	D66G	possibly damaging	Het
Sacs	T	C	14: 61,209,265	I2920T	probably damaging	Het
Safb2	T	C	17: 56,575,580	N351S	probably benign	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc13b	G	A	4: 43,241,164		probably benign	Het
Vars	A	G	17: 34,998,012	S489P	probably damaging	Het
Wars2	A	G	3: 99,216,572	K250E	probably damaging	Het
Zfp292	A	G	4: 34,816,424		probably benign	Het

Other mutations in Pcsk6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Pcsk6	APN	7	65927820	missense	probably damaging	1.00
IGL01609:Pcsk6	APN	7	66035273	splice site	probably null
IGL01986:Pcsk6	APN	7	65927877	missense	probably damaging	1.00
IGL02592:Pcsk6	APN	7	65969028	missense	probably damaging	1.00
IGL02720:Pcsk6	APN	7	65980247	nonsense	probably null
R0045:Pcsk6	UTSW	7	65962928	missense	probably damaging	1.00
R0045:Pcsk6	UTSW	7	65962928	missense	probably damaging	1.00
R0053:Pcsk6	UTSW	7	65983703	splice site	probably benign
R0053:Pcsk6	UTSW	7	65983703	splice site	probably benign
R0103:Pcsk6	UTSW	7	65929097	splice site	probably benign
R0103:Pcsk6	UTSW	7	65929097	splice site	probably benign
R0119:Pcsk6	UTSW	7	66039043	missense	probably benign	0.10
R0299:Pcsk6	UTSW	7	66039043	missense	probably benign	0.10
R0415:Pcsk6	UTSW	7	66033874	missense	probably damaging	1.00
R0496:Pcsk6	UTSW	7	65927249	missense	probably benign	0.00
R0518:Pcsk6	UTSW	7	65980167	missense	possibly damaging	0.64
R1456:Pcsk6	UTSW	7	66043535	missense	possibly damaging	0.87
R1613:Pcsk6	UTSW	7	65910311	splice site	probably benign
R1680:Pcsk6	UTSW	7	66035250	missense	probably benign	0.14
R1682:Pcsk6	UTSW	7	65910228	missense	probably damaging	1.00
R1987:Pcsk6	UTSW	7	65927287	missense	possibly damaging	0.60
R4191:Pcsk6	UTSW	7	66025308	missense	probably damaging	0.98
R4193:Pcsk6	UTSW	7	66025308	missense	probably damaging	0.98
R4577:Pcsk6	UTSW	7	65959266	nonsense	probably null
R4592:Pcsk6	UTSW	7	65931732	missense	possibly damaging	0.54
R4687:Pcsk6	UTSW	7	65983753	missense	probably damaging	1.00
R4697:Pcsk6	UTSW	7	65959241	missense	probably damaging	1.00
R4778:Pcsk6	UTSW	7	65959145	missense	probably damaging	1.00
R5065:Pcsk6	UTSW	7	65910299	missense	possibly damaging	0.84
R5218:Pcsk6	UTSW	7	66025288	missense	probably benign	0.01
R5356:Pcsk6	UTSW	7	65970592	missense	probably damaging	1.00
R5427:Pcsk6	UTSW	7	66033899	missense	probably benign	0.01
R5589:Pcsk6	UTSW	7	65929185	critical splice donor site	probably null
R5637:Pcsk6	UTSW	7	65968997	missense	probably damaging	1.00
R5888:Pcsk6	UTSW	7	66043624	missense	probably null
R5958:Pcsk6	UTSW	7	66043611	missense	probably damaging	1.00
R5997:Pcsk6	UTSW	7	65959293	missense	probably damaging	1.00
R6191:Pcsk6	UTSW	7	65929127	missense	probably benign	0.19
R6274:Pcsk6	UTSW	7	66033844	missense	probably damaging	1.00
R6374:Pcsk6	UTSW	7	65980155	missense	possibly damaging	0.80
R6393:Pcsk6	UTSW	7	65969014	missense	probably damaging	1.00
R6730:Pcsk6	UTSW	7	65980248	missense	probably damaging	1.00
R7205:Pcsk6	UTSW	7	66025408	critical splice donor site	probably null
R7493:Pcsk6	UTSW	7	66043566	missense	possibly damaging	0.53
R7570:Pcsk6	UTSW	7	66033898	missense	probably benign	0.03
R7731:Pcsk6	UTSW	7	66033893	missense	probably benign	0.00
R7779:Pcsk6	UTSW	7	66025404	missense	probably benign	0.03
R8042:Pcsk6	UTSW	7	65927935	missense	possibly damaging	0.87
R8734:Pcsk6	UTSW	7	65931733	missense	probably benign	0.06
R8805:Pcsk6	UTSW	7	65929143	missense	possibly damaging	0.67
R8987:Pcsk6	UTSW	7	65927227	nonsense	probably null
R9276:Pcsk6	UTSW	7	65910202	missense	probably damaging	1.00
R9492:Pcsk6	UTSW	7	66047598	missense	probably benign	0.02
R9747:Pcsk6	UTSW	7	65983722	missense	probably damaging	1.00
Z1177:Pcsk6	UTSW	7	65959113	missense	probably damaging	1.00
Z1177:Pcsk6	UTSW	7	66033811	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAAAGCTGGAAGCTCTGACCTCTTG -3'
(R):5'- ACCCGTGAATTACACTTTAAGCCCC -3'

Sequencing Primer
(F):5'- TGACCTCTTGCAGCAGGC -3'
(R):5'- AAGGTAGCTGGCCTGTTCAC -3'

Posted On

2013-09-30