Incidental Mutation 'R9261:Eml5'
ID 702276
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
MMRRC Submission 068990-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.216) question?
Stock # R9261 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 98753064-98867743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98822287 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 747 (V747A)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably benign
Transcript: ENSMUST00000065716
AA Change: V708A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: V708A

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223282
AA Change: V747A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,075,397 (GRCm39) E1043G probably benign Het
Agps T G 2: 75,684,850 (GRCm39) probably benign Het
Ahnak A G 19: 8,993,503 (GRCm39) E4929G possibly damaging Het
Arl6ip4 T A 5: 124,256,146 (GRCm39) probably benign Het
Cdhr17 T C 5: 17,006,547 (GRCm39) L88P possibly damaging Het
Clca3a2 G T 3: 144,525,158 (GRCm39) H25N probably benign Het
Cubn C T 2: 13,283,262 (GRCm39) D3559N probably damaging Het
Dmac2 T A 7: 25,320,345 (GRCm39) W15R probably benign Het
Dzank1 T C 2: 144,355,344 (GRCm39) E117G probably benign Het
Eml2 A G 7: 18,913,743 (GRCm39) T187A probably benign Het
Esr1 T A 10: 4,919,271 (GRCm39) S454T probably damaging Het
Evc2 A G 5: 37,537,895 (GRCm39) T528A probably benign Het
Fbxo5 T C 10: 5,752,325 (GRCm39) N96S probably damaging Het
Fcnb T C 2: 27,969,636 (GRCm39) T144A probably damaging Het
Fgf20 T A 8: 40,739,951 (GRCm39) probably benign Het
Gcg T C 2: 62,306,408 (GRCm39) probably benign Het
Gfm2 T A 13: 97,299,369 (GRCm39) Y363* probably null Het
Grwd1 C T 7: 45,475,381 (GRCm39) R387Q probably benign Het
Gstt2 C T 10: 75,669,511 (GRCm39) D59N possibly damaging Het
Herc1 A G 9: 66,412,129 (GRCm39) N4783S probably damaging Het
Hydin C A 8: 110,994,047 (GRCm39) A27E unknown Het
Iigp1c T A 18: 60,353,820 (GRCm39) probably benign Het
Ikbip A G 10: 90,932,249 (GRCm39) T298A possibly damaging Het
Il1rap A G 16: 26,541,724 (GRCm39) N655S possibly damaging Het
Kif21b C T 1: 136,077,162 (GRCm39) R395C probably damaging Het
Kif3a ATTGACG A 11: 53,484,248 (GRCm39) probably benign Het
Klhl40 A G 9: 121,609,002 (GRCm39) D389G probably benign Het
Ly6g A G 15: 75,030,529 (GRCm39) T116A probably damaging Het
Mast2 A G 4: 116,165,900 (GRCm39) L1276P probably damaging Het
Mitf A G 6: 97,990,704 (GRCm39) Q369R possibly damaging Het
Mtus2 T A 5: 148,243,453 (GRCm39) Y192* probably null Het
Nav1 T A 1: 135,388,095 (GRCm39) E1109D unknown Het
Nav2 A G 7: 49,246,904 (GRCm39) E2143G probably damaging Het
Nedd4 A G 9: 72,584,656 (GRCm39) Q119R possibly damaging Het
Nek9 A G 12: 85,359,841 (GRCm39) V537A probably damaging Het
Notum G T 11: 120,550,974 (GRCm39) T64K Het
Nudcd2 A G 11: 40,630,026 (GRCm39) N144S probably damaging Het
Nup205 A G 6: 35,176,792 (GRCm39) E596G probably benign Het
Olfml1 T A 7: 107,167,007 (GRCm39) L12Q possibly damaging Het
Or4f60 T A 2: 111,902,718 (GRCm39) D70V probably damaging Het
Or51k1 C T 7: 103,661,336 (GRCm39) C191Y probably damaging Het
Or52n2c A T 7: 104,574,305 (GRCm39) M222K probably benign Het
Or56b2 T A 7: 104,337,260 (GRCm39) F13I probably benign Het
Or6b13 A G 7: 139,782,563 (GRCm39) V40A probably benign Het
Ovgp1 T C 3: 105,893,883 (GRCm39) probably benign Het
Padi4 T C 4: 140,479,926 (GRCm39) N409S probably damaging Het
Pam T A 1: 97,903,620 (GRCm39) T38S probably benign Het
Piezo2 T C 18: 63,208,868 (GRCm39) I1382V possibly damaging Het
Pla2g12a A T 3: 129,684,080 (GRCm39) Q153L possibly damaging Het
Pla2g4e T A 2: 120,019,910 (GRCm39) H180L probably benign Het
Pou2af2 T A 9: 51,202,998 (GRCm39) H52L probably benign Het
Pprc1 A G 19: 46,050,868 (GRCm39) T169A unknown Het
Prrc2c A G 1: 162,505,622 (GRCm39) I2592T possibly damaging Het
Ptchd3 T A 11: 121,722,956 (GRCm39) I348N probably damaging Het
Ralgps1 T C 2: 33,226,571 (GRCm39) D40G probably damaging Het
Rbm19 T C 5: 120,256,810 (GRCm39) F41S probably damaging Het
Rbsn T C 6: 92,166,797 (GRCm39) M616V probably benign Het
Ryr1 A T 7: 28,751,813 (GRCm39) M3660K possibly damaging Het
Sidt2 A T 9: 45,861,396 (GRCm39) V246E probably damaging Het
Slc4a4 T C 5: 89,347,568 (GRCm39) W770R probably damaging Het
Spata31d1c T A 13: 65,184,680 (GRCm39) S741T probably damaging Het
Stk19 T G 17: 35,051,432 (GRCm39) Y108S possibly damaging Het
Stox2 T C 8: 47,645,441 (GRCm39) E673G possibly damaging Het
Tax1bp1 T A 6: 52,714,116 (GRCm39) C271S probably benign Het
Tmem161a C A 8: 70,631,572 (GRCm39) R167S probably damaging Het
Tnrc6c T A 11: 117,605,105 (GRCm39) V80E probably damaging Het
Trpa1 G A 1: 14,963,465 (GRCm39) H586Y probably damaging Het
Tsr1 A G 11: 74,799,056 (GRCm39) T746A probably damaging Het
Uqcrfs1 T C 13: 30,724,794 (GRCm39) I249V probably damaging Het
Vmn2r84 C A 10: 130,229,976 (GRCm39) E45D probably benign Het
Vnn3 A G 10: 23,741,607 (GRCm39) E304G probably damaging Het
Zfp541 G A 7: 15,816,029 (GRCm39) V839M possibly damaging Het
Zfp62 A G 11: 49,108,350 (GRCm39) K814E probably benign Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98,839,468 (GRCm39) splice site probably benign
IGL00473:Eml5 APN 12 98,771,751 (GRCm39) splice site probably benign
IGL01120:Eml5 APN 12 98,810,278 (GRCm39) missense probably benign
IGL01308:Eml5 APN 12 98,768,572 (GRCm39) missense probably damaging 1.00
IGL01790:Eml5 APN 12 98,765,191 (GRCm39) missense probably damaging 1.00
IGL01973:Eml5 APN 12 98,829,539 (GRCm39) missense probably benign
IGL02182:Eml5 APN 12 98,768,581 (GRCm39) missense probably damaging 1.00
IGL02201:Eml5 APN 12 98,760,683 (GRCm39) splice site probably benign
IGL02375:Eml5 APN 12 98,810,346 (GRCm39) missense probably damaging 1.00
IGL02397:Eml5 APN 12 98,756,933 (GRCm39) missense probably benign 0.07
IGL02480:Eml5 APN 12 98,842,502 (GRCm39) missense probably damaging 1.00
IGL02801:Eml5 APN 12 98,784,104 (GRCm39) missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98,825,100 (GRCm39) missense probably damaging 1.00
IGL03104:Eml5 APN 12 98,827,504 (GRCm39) nonsense probably null
IGL03158:Eml5 APN 12 98,793,773 (GRCm39) splice site probably benign
IGL03286:Eml5 APN 12 98,826,762 (GRCm39) missense probably damaging 1.00
IGL03380:Eml5 APN 12 98,840,906 (GRCm39) splice site probably benign
BB010:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98,791,031 (GRCm39) splice site probably null
R0624:Eml5 UTSW 12 98,831,738 (GRCm39) missense probably damaging 1.00
R0993:Eml5 UTSW 12 98,827,442 (GRCm39) missense probably benign 0.25
R1073:Eml5 UTSW 12 98,797,232 (GRCm39) missense probably damaging 1.00
R1183:Eml5 UTSW 12 98,758,305 (GRCm39) missense probably benign 0.31
R1352:Eml5 UTSW 12 98,797,262 (GRCm39) splice site probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1503:Eml5 UTSW 12 98,797,433 (GRCm39) missense probably damaging 0.99
R1538:Eml5 UTSW 12 98,760,535 (GRCm39) missense probably damaging 0.99
R1689:Eml5 UTSW 12 98,797,194 (GRCm39) missense probably damaging 1.00
R1773:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1775:Eml5 UTSW 12 98,818,963 (GRCm39) splice site probably null
R1791:Eml5 UTSW 12 98,853,315 (GRCm39) missense probably benign 0.31
R1856:Eml5 UTSW 12 98,776,843 (GRCm39) missense probably damaging 1.00
R1919:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1957:Eml5 UTSW 12 98,826,220 (GRCm39) missense probably damaging 1.00
R1962:Eml5 UTSW 12 98,842,570 (GRCm39) missense probably damaging 0.99
R2033:Eml5 UTSW 12 98,757,645 (GRCm39) missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98,760,525 (GRCm39) missense probably benign 0.33
R2073:Eml5 UTSW 12 98,768,705 (GRCm39) missense probably damaging 0.99
R2143:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2144:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2158:Eml5 UTSW 12 98,810,205 (GRCm39) splice site probably benign
R2164:Eml5 UTSW 12 98,853,356 (GRCm39) missense probably damaging 0.99
R2175:Eml5 UTSW 12 98,842,482 (GRCm39) nonsense probably null
R2200:Eml5 UTSW 12 98,791,676 (GRCm39) missense probably damaging 1.00
R2234:Eml5 UTSW 12 98,807,840 (GRCm39) missense probably damaging 1.00
R2504:Eml5 UTSW 12 98,810,364 (GRCm39) missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2958:Eml5 UTSW 12 98,842,437 (GRCm39) missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98,847,067 (GRCm39) splice site probably null
R3118:Eml5 UTSW 12 98,831,753 (GRCm39) missense probably damaging 0.97
R3735:Eml5 UTSW 12 98,822,248 (GRCm39) missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98,782,283 (GRCm39) missense probably damaging 1.00
R3900:Eml5 UTSW 12 98,791,782 (GRCm39) missense probably damaging 1.00
R3973:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R3976:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R4105:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4107:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4108:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4109:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4258:Eml5 UTSW 12 98,831,693 (GRCm39) missense probably benign 0.01
R4381:Eml5 UTSW 12 98,782,214 (GRCm39) missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98,803,600 (GRCm39) missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98,765,111 (GRCm39) missense probably damaging 1.00
R4775:Eml5 UTSW 12 98,768,566 (GRCm39) missense probably benign 0.05
R4850:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5007:Eml5 UTSW 12 98,797,224 (GRCm39) missense probably damaging 1.00
R5092:Eml5 UTSW 12 98,758,875 (GRCm39) missense probably damaging 1.00
R5123:Eml5 UTSW 12 98,840,771 (GRCm39) missense probably damaging 1.00
R5124:Eml5 UTSW 12 98,758,301 (GRCm39) missense probably damaging 1.00
R5273:Eml5 UTSW 12 98,756,947 (GRCm39) missense probably damaging 1.00
R5369:Eml5 UTSW 12 98,825,042 (GRCm39) missense probably damaging 1.00
R5430:Eml5 UTSW 12 98,760,417 (GRCm39) missense probably damaging 1.00
R5748:Eml5 UTSW 12 98,791,814 (GRCm39) missense probably damaging 0.99
R5769:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5832:Eml5 UTSW 12 98,842,447 (GRCm39) missense probably benign
R6113:Eml5 UTSW 12 98,790,933 (GRCm39) nonsense probably null
R6131:Eml5 UTSW 12 98,827,510 (GRCm39) missense probably damaging 0.99
R6175:Eml5 UTSW 12 98,760,715 (GRCm39) missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98,829,388 (GRCm39) missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98,837,143 (GRCm39) missense probably damaging 0.98
R6375:Eml5 UTSW 12 98,765,127 (GRCm39)
R6528:Eml5 UTSW 12 98,790,896 (GRCm39) missense probably benign 0.18
R6657:Eml5 UTSW 12 98,757,664 (GRCm39) missense probably damaging 0.98
R6717:Eml5 UTSW 12 98,793,765 (GRCm39) missense probably damaging 1.00
R6751:Eml5 UTSW 12 98,831,659 (GRCm39) missense probably damaging 1.00
R6833:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6834:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6972:Eml5 UTSW 12 98,842,439 (GRCm39) missense probably benign 0.00
R7091:Eml5 UTSW 12 98,768,733 (GRCm39) missense probably benign 0.16
R7353:Eml5 UTSW 12 98,791,683 (GRCm39) missense
R7644:Eml5 UTSW 12 98,822,203 (GRCm39) missense probably benign 0.05
R7694:Eml5 UTSW 12 98,758,822 (GRCm39) missense probably damaging 0.99
R7842:Eml5 UTSW 12 98,760,394 (GRCm39) missense probably damaging 1.00
R7933:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98,758,773 (GRCm39) critical splice donor site probably null
R8198:Eml5 UTSW 12 98,825,145 (GRCm39) nonsense probably null
R8482:Eml5 UTSW 12 98,842,560 (GRCm39) missense probably damaging 1.00
R8732:Eml5 UTSW 12 98,782,218 (GRCm39) missense probably damaging 0.99
R8956:Eml5 UTSW 12 98,818,952 (GRCm39) missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98,776,829 (GRCm39) missense probably damaging 0.99
R9131:Eml5 UTSW 12 98,825,099 (GRCm39) missense probably damaging 1.00
R9258:Eml5 UTSW 12 98,810,376 (GRCm39) missense possibly damaging 0.77
R9276:Eml5 UTSW 12 98,765,060 (GRCm39) missense probably damaging 0.99
R9301:Eml5 UTSW 12 98,848,292 (GRCm39) nonsense probably null
R9368:Eml5 UTSW 12 98,762,837 (GRCm39) missense probably benign 0.31
R9392:Eml5 UTSW 12 98,867,199 (GRCm39) missense probably damaging 1.00
R9393:Eml5 UTSW 12 98,842,433 (GRCm39) missense probably benign 0.35
R9449:Eml5 UTSW 12 98,827,554 (GRCm39) missense probably damaging 1.00
R9570:Eml5 UTSW 12 98,782,243 (GRCm39) missense probably benign 0.15
T0722:Eml5 UTSW 12 98,807,841 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AACTGGCAAGCTTAGGTAACAATG -3'
(R):5'- TTTCTGCACCAGTAAGCCAC -3'

Sequencing Primer
(F):5'- TGCCATATTGGTGGTAGC -3'
(R):5'- TTCAGTTAGCAATATAATGGGTGC -3'
Posted On 2022-03-25