Incidental Mutation 'R9262:Mgam'
ID 702311
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R9262 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 40628831-40769123 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 40746488 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071535
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201148
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202779
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202966
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,588 M473V probably benign Het
4933409G03Rik A T 2: 68,613,031 H192L unknown Het
Abca4 T A 3: 122,170,990 C2149S probably damaging Het
Abl2 G A 1: 156,642,250 G1028D possibly damaging Het
Adgre1 A G 17: 57,447,941 T680A probably damaging Het
Amn G A 12: 111,271,151 W10* probably null Het
Ankhd1 G T 18: 36,632,746 V140F Het
Asnsd1 A T 1: 53,344,775 N613K probably benign Het
Bbs2 A T 8: 94,080,915 I417N probably damaging Het
Cad T A 5: 31,067,665 W971R probably null Het
Cand2 A T 6: 115,782,769 I134F probably benign Het
Ccdc154 C A 17: 25,170,186 H453N probably damaging Het
Ccdc7a T A 8: 128,759,796 H1601L possibly damaging Het
Ccdc9 A C 7: 16,278,475 S261A probably benign Het
Cdkl3 T A 11: 52,025,875 S277T probably benign Het
Cipc T A 12: 86,952,723 Y8* probably null Het
Cramp1l A G 17: 25,013,946 S27P probably damaging Het
Csf1r A T 18: 61,110,334 M141L probably benign Het
Csf2rb2 G T 15: 78,284,335 F873L probably damaging Het
Dchs1 G A 7: 105,755,626 R2570W probably damaging Het
Dmxl1 A T 18: 49,843,852 N94Y probably benign Het
Dnajc10 A G 2: 80,346,621 K640R probably benign Het
Epha8 A C 4: 136,931,684 H886Q probably benign Het
Fcgbp G C 7: 28,120,527 D2560H probably damaging Het
Fry T G 5: 150,381,644 F605V probably damaging Het
Fsip2 A G 2: 82,977,318 N1327S probably benign Het
Gm12117 T C 11: 33,276,001 T112A probably benign Het
Gm3604 A T 13: 62,369,883 N220K probably damaging Het
Gm572 T C 4: 148,651,195 V27A probably benign Het
Gm6614 G T 6: 141,980,868 F597L probably damaging Het
Gm8251 A G 1: 44,057,109 S1610P possibly damaging Het
Gm853 A G 4: 130,220,360 V88A possibly damaging Het
Gpr39 A G 1: 125,872,787 K425R probably benign Het
Heatr3 A G 8: 88,156,469 D349G probably benign Het
Hip1 A G 5: 135,449,687 S248P probably damaging Het
Itga11 A G 9: 62,752,396 probably benign Het
Itga3 C T 11: 95,065,799 V210I probably benign Het
Jmjd1c T C 10: 67,248,014 I2173T probably benign Het
Klf13 G A 7: 63,924,708 Q21* probably null Het
Kmt2a A T 9: 44,819,925 S3032T probably benign Het
Krt34 T C 11: 100,040,025 R184G probably benign Het
Krtap16-1 T C 11: 99,986,168 T137A probably benign Het
Mog T C 17: 37,014,756 T196A possibly damaging Het
Ms4a6d T C 19: 11,601,852 Y87C possibly damaging Het
Ndrg4 C T 8: 95,709,184 probably benign Het
Nsd1 T A 13: 55,247,058 M927K possibly damaging Het
Olfr1246 G T 2: 89,591,091 T8K probably damaging Het
Olfr323 T A 11: 58,625,456 M197L probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcdhac2 A G 18: 37,146,042 R692G possibly damaging Het
Pcsk4 T A 10: 80,325,030 S321C probably damaging Het
Pi4ka A G 16: 17,302,995 F1292L Het
Pigv G T 4: 133,669,799 P6Q possibly damaging Het
Pkhd1 A C 1: 20,548,127 S927A probably benign Het
Pnpla3 A T 15: 84,171,162 I90F probably benign Het
Pole C A 5: 110,325,556 L1739I probably damaging Het
Pole T A 5: 110,325,557 L1739H probably damaging Het
Rbm12 A T 2: 156,097,397 N318K possibly damaging Het
Rpl18a A T 8: 70,895,535 L168Q probably benign Het
Ryr2 T C 13: 11,750,968 N1294S probably damaging Het
Sema5b T C 16: 35,632,853 L98P possibly damaging Het
Smg7 A G 1: 152,845,511 V650A probably damaging Het
Strada C T 11: 106,184,618 R13Q probably damaging Het
Sun1 T C 5: 139,215,163 S37P unknown Het
Syce1l T C 8: 113,654,106 probably null Het
Tdg T A 10: 82,644,673 F263L probably damaging Het
Tead3 G T 17: 28,341,521 S36R probably benign Het
Timm44 A G 8: 4,260,621 L377P probably damaging Het
Tk1 C T 11: 117,825,755 V9M probably benign Het
Trim36 A G 18: 46,167,439 Y722H probably benign Het
Ttn A T 2: 76,809,888 M13792K possibly damaging Het
Unc80 A G 1: 66,555,252 probably benign Het
Usp46 G T 5: 74,029,304 A133E probably benign Het
Wnk2 T A 13: 49,067,954 R1240S probably benign Het
Zfp821 G A 8: 109,724,350 R325Q probably damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
BB002:Mgam UTSW 6 40759051 missense probably damaging 0.99
BB012:Mgam UTSW 6 40759051 missense probably damaging 0.99
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 splice site probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 splice site probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
R7525:Mgam UTSW 6 40766020 missense probably benign 0.01
R7530:Mgam UTSW 6 40709218 splice site probably null
R7570:Mgam UTSW 6 40746433 missense probably benign 0.16
R7669:Mgam UTSW 6 40659010 missense probably benign 0.00
R7679:Mgam UTSW 6 40643046 missense probably damaging 0.98
R7746:Mgam UTSW 6 40668193 missense probably damaging 0.99
R7859:Mgam UTSW 6 40740179 missense possibly damaging 0.75
R7925:Mgam UTSW 6 40759051 missense probably damaging 0.99
R8206:Mgam UTSW 6 40680235 missense probably benign 0.00
R8244:Mgam UTSW 6 40750586 missense probably damaging 1.00
R8309:Mgam UTSW 6 40745177 missense possibly damaging 0.88
R8472:Mgam UTSW 6 40694526 splice site probably null
R8758:Mgam UTSW 6 40729043 missense probably benign 0.41
R8777:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8783:Mgam UTSW 6 40656489 missense probably damaging 0.99
R8939:Mgam UTSW 6 40763203 critical splice donor site probably null
R8968:Mgam UTSW 6 40757811 critical splice acceptor site probably null
R8987:Mgam UTSW 6 40729636 missense probably damaging 1.00
R9055:Mgam UTSW 6 40714729 intron probably benign
R9171:Mgam UTSW 6 40768212 missense possibly damaging 0.76
R9252:Mgam UTSW 6 40729643 missense probably damaging 0.99
R9258:Mgam UTSW 6 40680187 missense probably benign
R9287:Mgam UTSW 6 40728971 intron probably benign
R9521:Mgam UTSW 6 40745184 missense probably damaging 1.00
R9589:Mgam UTSW 6 40750585 missense probably damaging 1.00
R9658:Mgam UTSW 6 40744377 missense possibly damaging 0.93
R9784:Mgam UTSW 6 40759090 missense probably damaging 1.00
RF011:Mgam UTSW 6 40757436 missense probably damaging 1.00
RF020:Mgam UTSW 6 40685309 missense probably damaging 1.00
RF023:Mgam UTSW 6 40680708 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Z1176:Mgam UTSW 6 40677644 critical splice donor site probably null
Z1176:Mgam UTSW 6 40729066 missense probably damaging 1.00
Z1177:Mgam UTSW 6 40740071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGACTCTCAACTCCTTG -3'
(R):5'- AGATGTTAGGAGACTATGTGCATG -3'

Sequencing Primer
(F):5'- GGGACTCTCAACTCCTTGGCTTC -3'
(R):5'- AATTCGATGCCCCAGTGTAG -3'
Posted On 2022-03-25