Mutagenetix > Incidental Mutation

Incidental Mutation 'R9262:Dchs1'

702317

Institutional Source

Beutler Lab

Gene Symbol

Dchs1

Ensembl Gene

ENSMUSG00000036862

Gene Name

dachsous cadherin related 1

Synonyms

3110041P15Rik, C130033F22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9262 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105752990-105787654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 105755626 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 2570 (R2570W)

Ref Sequence

ENSEMBL: ENSMUSP00000077574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000033184

SMART Domains

Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
Pro-kuma_activ	32	176	4.53e-50	SMART
low complexity region	177	189	N/A	INTRINSIC
Pfam:Peptidase_S8	251	492	1.1e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000078482
AA Change: R2570W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: R2570W

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
CA	58	135	5.2e-11	SMART
CA	159	247	6.1e-17	SMART
CA	271	354	2.6e-30	SMART
CA	382	464	7.8e-26	SMART
CA	489	570	1.2e-34	SMART
CA	594	677	1.9e-27	SMART
CA	701	782	5.3e-11	SMART
CA	806	886	1e-12	SMART
CA	910	990	3.3e-14	SMART
CA	1016	1097	3.6e-18	SMART
CA	1121	1203	3.1e-34	SMART
CA	1233	1307	8.8e-16	SMART
low complexity region	1323	1335	N/A	INTRINSIC
CA	1344	1427	9.9e-9	SMART
CA	1451	1537	1.5e-23	SMART
CA	1560	1640	7.2e-32	SMART
CA	1664	1742	1.8e-31	SMART
CA	1765	1846	7.8e-30	SMART
CA	1870	1951	3.7e-26	SMART
low complexity region	1957	1965	N/A	INTRINSIC
CA	1979	2059	1.1e-6	SMART
CA	2083	2162	2.7e-18	SMART
CA	2186	2268	2.2e-26	SMART
CA	2291	2367	1e-18	SMART
CA	2391	2473	1.8e-23	SMART
CA	2497	2593	3.5e-21	SMART
CA	2617	2697	1.2e-25	SMART
CA	2721	2804	1.9e-18	SMART
CA	2828	2919	3e-3	SMART
transmembrane domain	2932	2954	N/A	INTRINSIC
low complexity region	3001	3017	N/A	INTRINSIC
low complexity region	3046	3055	N/A	INTRINSIC
low complexity region	3088	3097	N/A	INTRINSIC
low complexity region	3185	3196	N/A	INTRINSIC
low complexity region	3237	3259	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140959

Predicted Effect

probably benign
Transcript: ENSMUST00000210066

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,588	M473V	probably benign	Het
4933409G03Rik	A	T	2: 68,613,031	H192L	unknown	Het
Abca4	T	A	3: 122,170,990	C2149S	probably damaging	Het
Abl2	G	A	1: 156,642,250	G1028D	possibly damaging	Het
Adgre1	A	G	17: 57,447,941	T680A	probably damaging	Het
Amn	G	A	12: 111,271,151	W10*	probably null	Het
Ankhd1	G	T	18: 36,632,746	V140F		Het
Asnsd1	A	T	1: 53,344,775	N613K	probably benign	Het
Bbs2	A	T	8: 94,080,915	I417N	probably damaging	Het
Cad	T	A	5: 31,067,665	W971R	probably null	Het
Cand2	A	T	6: 115,782,769	I134F	probably benign	Het
Ccdc154	C	A	17: 25,170,186	H453N	probably damaging	Het
Ccdc7a	T	A	8: 128,759,796	H1601L	possibly damaging	Het
Ccdc9	A	C	7: 16,278,475	S261A	probably benign	Het
Cdkl3	T	A	11: 52,025,875	S277T	probably benign	Het
Cipc	T	A	12: 86,952,723	Y8*	probably null	Het
Cramp1l	A	G	17: 25,013,946	S27P	probably damaging	Het
Csf1r	A	T	18: 61,110,334	M141L	probably benign	Het
Csf2rb2	G	T	15: 78,284,335	F873L	probably damaging	Het
Dmxl1	A	T	18: 49,843,852	N94Y	probably benign	Het
Dnajc10	A	G	2: 80,346,621	K640R	probably benign	Het
Epha8	A	C	4: 136,931,684	H886Q	probably benign	Het
Fcgbp	G	C	7: 28,120,527	D2560H	probably damaging	Het
Fry	T	G	5: 150,381,644	F605V	probably damaging	Het
Fsip2	A	G	2: 82,977,318	N1327S	probably benign	Het
Gm12117	T	C	11: 33,276,001	T112A	probably benign	Het
Gm3604	A	T	13: 62,369,883	N220K	probably damaging	Het
Gm572	T	C	4: 148,651,195	V27A	probably benign	Het
Gm6614	G	T	6: 141,980,868	F597L	probably damaging	Het
Gm8251	A	G	1: 44,057,109	S1610P	possibly damaging	Het
Gm853	A	G	4: 130,220,360	V88A	possibly damaging	Het
Gpr39	A	G	1: 125,872,787	K425R	probably benign	Het
Heatr3	A	G	8: 88,156,469	D349G	probably benign	Het
Hip1	A	G	5: 135,449,687	S248P	probably damaging	Het
Itga11	A	G	9: 62,752,396		probably benign	Het
Itga3	C	T	11: 95,065,799	V210I	probably benign	Het
Jmjd1c	T	C	10: 67,248,014	I2173T	probably benign	Het
Klf13	G	A	7: 63,924,708	Q21*	probably null	Het
Kmt2a	A	T	9: 44,819,925	S3032T	probably benign	Het
Krt34	T	C	11: 100,040,025	R184G	probably benign	Het
Krtap16-1	T	C	11: 99,986,168	T137A	probably benign	Het
Mgam	T	C	6: 40,746,488		probably null	Het
Mog	T	C	17: 37,014,756	T196A	possibly damaging	Het
Ms4a6d	T	C	19: 11,601,852	Y87C	possibly damaging	Het
Ndrg4	C	T	8: 95,709,184		probably benign	Het
Nsd1	T	A	13: 55,247,058	M927K	possibly damaging	Het
Olfr1246	G	T	2: 89,591,091	T8K	probably damaging	Het
Olfr323	T	A	11: 58,625,456	M197L	probably benign	Het
Ovgp1	T	C	3: 105,986,567		probably benign	Het
Pcdhac2	A	G	18: 37,146,042	R692G	possibly damaging	Het
Pcsk4	T	A	10: 80,325,030	S321C	probably damaging	Het
Pi4ka	A	G	16: 17,302,995	F1292L		Het
Pigv	G	T	4: 133,669,799	P6Q	possibly damaging	Het
Pkhd1	A	C	1: 20,548,127	S927A	probably benign	Het
Pnpla3	A	T	15: 84,171,162	I90F	probably benign	Het
Pole	C	A	5: 110,325,556	L1739I	probably damaging	Het
Pole	T	A	5: 110,325,557	L1739H	probably damaging	Het
Rbm12	A	T	2: 156,097,397	N318K	possibly damaging	Het
Rpl18a	A	T	8: 70,895,535	L168Q	probably benign	Het
Ryr2	T	C	13: 11,750,968	N1294S	probably damaging	Het
Sema5b	T	C	16: 35,632,853	L98P	possibly damaging	Het
Smg7	A	G	1: 152,845,511	V650A	probably damaging	Het
Strada	C	T	11: 106,184,618	R13Q	probably damaging	Het
Sun1	T	C	5: 139,215,163	S37P	unknown	Het
Syce1l	T	C	8: 113,654,106		probably null	Het
Tdg	T	A	10: 82,644,673	F263L	probably damaging	Het
Tead3	G	T	17: 28,341,521	S36R	probably benign	Het
Timm44	A	G	8: 4,260,621	L377P	probably damaging	Het
Tk1	C	T	11: 117,825,755	V9M	probably benign	Het
Trim36	A	G	18: 46,167,439	Y722H	probably benign	Het
Ttn	A	T	2: 76,809,888	M13792K	possibly damaging	Het
Unc80	A	G	1: 66,555,252		probably benign	Het
Usp46	G	T	5: 74,029,304	A133E	probably benign	Het
Wnk2	T	A	13: 49,067,954	R1240S	probably benign	Het
Zfp821	G	A	8: 109,724,350	R325Q	probably damaging	Het

Other mutations in Dchs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Dchs1	APN	7	105758743	missense	probably damaging	1.00
IGL00422:Dchs1	APN	7	105758029	missense	possibly damaging	0.88
IGL00427:Dchs1	APN	7	105758424	missense	probably damaging	0.98
IGL00469:Dchs1	APN	7	105755261	missense	probably damaging	1.00
IGL00470:Dchs1	APN	7	105758207	missense	probably damaging	1.00
IGL00534:Dchs1	APN	7	105757943	missense	probably benign
IGL01292:Dchs1	APN	7	105760891	missense	probably damaging	0.98
IGL01380:Dchs1	APN	7	105762211	missense	probably damaging	1.00
IGL01396:Dchs1	APN	7	105772283	missense	probably damaging	1.00
IGL01448:Dchs1	APN	7	105771927	missense	probably damaging	0.98
IGL01759:Dchs1	APN	7	105755302	missense	probably benign	0.00
IGL01829:Dchs1	APN	7	105755397	missense	probably damaging	0.99
IGL01946:Dchs1	APN	7	105759105	missense	probably damaging	1.00
IGL01955:Dchs1	APN	7	105757591	missense	probably benign	0.00
IGL02012:Dchs1	APN	7	105764297	missense	probably damaging	0.98
IGL02222:Dchs1	APN	7	105764887	missense	probably damaging	1.00
IGL02261:Dchs1	APN	7	105772569	missense	probably damaging	1.00
IGL02365:Dchs1	APN	7	105755188	missense	probably benign	0.22
IGL02430:Dchs1	APN	7	105771971	missense	probably benign	0.34
IGL02500:Dchs1	APN	7	105755806	missense	probably benign
IGL02741:Dchs1	APN	7	105757323	missense	probably damaging	1.00
IGL02890:Dchs1	APN	7	105756491	missense	probably damaging	1.00
IGL03213:Dchs1	APN	7	105755072	missense	probably damaging	1.00
G1patch:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
P0026:Dchs1	UTSW	7	105758405	missense	probably damaging	0.99
PIT4377001:Dchs1	UTSW	7	105757588	missense	probably damaging	1.00
PIT4791001:Dchs1	UTSW	7	105758971	missense	probably damaging	1.00
R0013:Dchs1	UTSW	7	105755836	missense	possibly damaging	0.90
R0090:Dchs1	UTSW	7	105755932	missense	probably benign	0.18
R0091:Dchs1	UTSW	7	105766094	splice site	probably benign
R0193:Dchs1	UTSW	7	105764983	missense	probably benign	0.40
R0395:Dchs1	UTSW	7	105758538	missense	probably damaging	1.00
R0448:Dchs1	UTSW	7	105765927	missense	probably benign	0.00
R0480:Dchs1	UTSW	7	105771489	missense	probably benign	0.14
R0485:Dchs1	UTSW	7	105772727	missense	probably benign	0.00
R0566:Dchs1	UTSW	7	105759195	missense	probably benign	0.00
R0571:Dchs1	UTSW	7	105771996	missense	probably damaging	1.00
R0573:Dchs1	UTSW	7	105758778	missense	probably damaging	0.98
R0577:Dchs1	UTSW	7	105764255	missense	possibly damaging	0.78
R0622:Dchs1	UTSW	7	105763449	missense	probably damaging	1.00
R0654:Dchs1	UTSW	7	105772349	missense	probably damaging	1.00
R0677:Dchs1	UTSW	7	105764984	missense	probably damaging	1.00
R1171:Dchs1	UTSW	7	105757714	missense	probably benign
R1241:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R1389:Dchs1	UTSW	7	105755571	missense	probably benign	0.40
R1427:Dchs1	UTSW	7	105766191	missense	probably benign	0.06
R1458:Dchs1	UTSW	7	105755244	missense	probably damaging	1.00
R1513:Dchs1	UTSW	7	105772071	nonsense	probably null
R1524:Dchs1	UTSW	7	105764525	missense	probably damaging	1.00
R1525:Dchs1	UTSW	7	105758931	missense	probably damaging	1.00
R1534:Dchs1	UTSW	7	105772040	missense	probably damaging	0.98
R1567:Dchs1	UTSW	7	105771861	missense	probably benign	0.01
R1577:Dchs1	UTSW	7	105765955	missense	probably damaging	1.00
R1603:Dchs1	UTSW	7	105762770	missense	probably benign	0.24
R1676:Dchs1	UTSW	7	105754921	missense	probably benign	0.40
R1794:Dchs1	UTSW	7	105771720	missense	probably benign	0.02
R1826:Dchs1	UTSW	7	105757627	missense	probably damaging	1.00
R1892:Dchs1	UTSW	7	105764156	missense	probably benign	0.00
R1924:Dchs1	UTSW	7	105772280	missense	possibly damaging	0.81
R1932:Dchs1	UTSW	7	105765902	missense	probably damaging	1.00
R1962:Dchs1	UTSW	7	105764201	missense	probably damaging	1.00
R1985:Dchs1	UTSW	7	105772398	missense	possibly damaging	0.72
R1993:Dchs1	UTSW	7	105762548	missense	probably benign	0.00
R2007:Dchs1	UTSW	7	105755325	missense	probably damaging	1.00
R2316:Dchs1	UTSW	7	105764204	missense	possibly damaging	0.71
R2351:Dchs1	UTSW	7	105754094	missense	probably benign
R2474:Dchs1	UTSW	7	105755074	missense	probably benign	0.37
R2474:Dchs1	UTSW	7	105772838	missense	probably damaging	1.00
R3429:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3430:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3737:Dchs1	UTSW	7	105762316	missense	possibly damaging	0.88
R3767:Dchs1	UTSW	7	105757085	missense	possibly damaging	0.67
R3874:Dchs1	UTSW	7	105761635	missense	probably damaging	1.00
R3883:Dchs1	UTSW	7	105762563	missense	probably damaging	1.00
R4105:Dchs1	UTSW	7	105765140	missense	probably damaging	1.00
R4209:Dchs1	UTSW	7	105766190	missense	probably damaging	0.99
R4329:Dchs1	UTSW	7	105753759	missense	probably damaging	1.00
R4516:Dchs1	UTSW	7	105754852	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105754765	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105758973	missense	probably benign
R4588:Dchs1	UTSW	7	105756041	missense	probably benign
R4613:Dchs1	UTSW	7	105772724	missense	probably damaging	1.00
R4632:Dchs1	UTSW	7	105754355	missense	probably benign	0.02
R4696:Dchs1	UTSW	7	105764627	missense	probably damaging	1.00
R4725:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4725:Dchs1	UTSW	7	105765552	missense	probably damaging	1.00
R4738:Dchs1	UTSW	7	105758673	missense	probably damaging	0.96
R4768:Dchs1	UTSW	7	105771620	missense	possibly damaging	0.96
R4784:Dchs1	UTSW	7	105765926	missense	probably damaging	1.00
R4864:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4880:Dchs1	UTSW	7	105755730	missense	probably benign	0.00
R4909:Dchs1	UTSW	7	105766255	missense	probably damaging	1.00
R5102:Dchs1	UTSW	7	105772177	missense	probably benign	0.09
R5109:Dchs1	UTSW	7	105765014	missense	probably benign
R5126:Dchs1	UTSW	7	105753517	missense	probably damaging	1.00
R5149:Dchs1	UTSW	7	105755658	missense	probably damaging	0.98
R5330:Dchs1	UTSW	7	105754602	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105772055	missense	probably damaging	1.00
R5386:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5622:Dchs1	UTSW	7	105755293	missense	probably benign	0.11
R5623:Dchs1	UTSW	7	105772769	missense	probably damaging	1.00
R5708:Dchs1	UTSW	7	105772809	missense	probably damaging	1.00
R5718:Dchs1	UTSW	7	105755748	missense	probably benign	0.01
R5743:Dchs1	UTSW	7	105771596	missense	probably benign
R5759:Dchs1	UTSW	7	105764176	missense	probably damaging	0.99
R5772:Dchs1	UTSW	7	105773040	missense	probably damaging	1.00
R5860:Dchs1	UTSW	7	105772035	missense	probably damaging	1.00
R5916:Dchs1	UTSW	7	105759166	missense	probably damaging	1.00
R5965:Dchs1	UTSW	7	105755925	missense	probably damaging	1.00
R5997:Dchs1	UTSW	7	105754095	missense	probably benign	0.08
R6065:Dchs1	UTSW	7	105755421	missense	probably damaging	1.00
R6136:Dchs1	UTSW	7	105760925	missense	probably benign
R6137:Dchs1	UTSW	7	105765106	missense	probably damaging	0.99
R6324:Dchs1	UTSW	7	105764938	missense	probably benign	0.05
R6363:Dchs1	UTSW	7	105758472	missense	probably benign	0.12
R6466:Dchs1	UTSW	7	105764541	missense	probably benign	0.09
R6544:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R6572:Dchs1	UTSW	7	105758806	missense	possibly damaging	0.94
R6579:Dchs1	UTSW	7	105762913	missense	probably benign	0.17
R6632:Dchs1	UTSW	7	105761878	missense	probably damaging	1.00
R6725:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
R6789:Dchs1	UTSW	7	105757003	missense	possibly damaging	0.61
R6868:Dchs1	UTSW	7	105763503	missense	possibly damaging	0.91
R7058:Dchs1	UTSW	7	105757021	missense	probably benign
R7064:Dchs1	UTSW	7	105763185	missense	probably damaging	0.99
R7076:Dchs1	UTSW	7	105761871	missense	probably benign	0.04
R7191:Dchs1	UTSW	7	105765439	missense	possibly damaging	0.89
R7298:Dchs1	UTSW	7	105755131	nonsense	probably null
R7380:Dchs1	UTSW	7	105758628	missense	probably benign	0.35
R7438:Dchs1	UTSW	7	105754948	missense	probably benign	0.30
R7496:Dchs1	UTSW	7	105761859	missense	probably damaging	1.00
R7534:Dchs1	UTSW	7	105772373	missense	probably benign	0.00
R7604:Dchs1	UTSW	7	105765982	missense	probably damaging	1.00
R7631:Dchs1	UTSW	7	105759238	missense	probably benign
R7821:Dchs1	UTSW	7	105765145	missense	probably benign	0.00
R7834:Dchs1	UTSW	7	105765567	missense	probably benign	0.39
R7841:Dchs1	UTSW	7	105762973	missense	probably benign
R7913:Dchs1	UTSW	7	105759228	missense	possibly damaging	0.61
R8041:Dchs1	UTSW	7	105755188	missense	probably benign	0.45
R8076:Dchs1	UTSW	7	105755921	missense	possibly damaging	0.52
R8076:Dchs1	UTSW	7	105761982	missense	probably damaging	1.00
R8087:Dchs1	UTSW	7	105753499	missense	probably benign	0.41
R8125:Dchs1	UTSW	7	105764882	missense	possibly damaging	0.91
R8223:Dchs1	UTSW	7	105762617	missense	possibly damaging	0.81
R8239:Dchs1	UTSW	7	105765511	missense	probably benign	0.22
R8476:Dchs1	UTSW	7	105758808	missense	probably benign	0.05
R8497:Dchs1	UTSW	7	105758961	missense	probably damaging	1.00
R8770:Dchs1	UTSW	7	105771738	missense	probably damaging	1.00
R8856:Dchs1	UTSW	7	105760857	missense	probably damaging	1.00
R8866:Dchs1	UTSW	7	105755390	missense	probably benign	0.00
R8948:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R8950:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R9029:Dchs1	UTSW	7	105753712	missense	probably benign	0.13
R9039:Dchs1	UTSW	7	105756008	missense	probably benign	0.11
R9081:Dchs1	UTSW	7	105754429	missense	probably benign	0.00
R9134:Dchs1	UTSW	7	105755703	missense	probably damaging	0.96
R9159:Dchs1	UTSW	7	105765919	missense	probably benign
R9162:Dchs1	UTSW	7	105765525	missense	probably damaging	1.00
R9169:Dchs1	UTSW	7	105772907	missense	probably damaging	1.00
R9292:Dchs1	UTSW	7	105753913	missense	probably damaging	1.00
R9325:Dchs1	UTSW	7	105766195	missense	possibly damaging	0.51
R9376:Dchs1	UTSW	7	105765774	critical splice donor site	probably null
R9392:Dchs1	UTSW	7	105772662	missense	probably benign	0.09
R9619:Dchs1	UTSW	7	105764455	missense	probably benign	0.07
R9680:Dchs1	UTSW	7	105762418	missense	probably damaging	1.00
R9687:Dchs1	UTSW	7	105757984	missense	probably damaging	0.99
R9747:Dchs1	UTSW	7	105763475	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105757693	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105758551	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTTCTCATCCAGCTCAAAGAG -3'
(R):5'- GCATCATCAGTGGCAATCGG -3'

Sequencing Primer
(F):5'- TCACCTGAACTAAGAGTGAAATGC -3'
(R):5'- GGGCCGAGTTTTCCAGCTG -3'

Posted On

2022-03-25