Incidental Mutation 'R0748:Faap100'
ID70232
Institutional Source Beutler Lab
Gene Symbol Faap100
Ensembl Gene ENSMUSG00000025384
Gene NameFanconi anemia core complex associated protein 100
Synonyms2310003H01Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R0748 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120369055-120378764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120372171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 787 (V787A)
Ref Sequence ENSEMBL: ENSMUSP00000026448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026445] [ENSMUST00000026448]
Predicted Effect probably benign
Transcript: ENSMUST00000026445
SMART Domains Protein: ENSMUSP00000026445
Gene: ENSMUSG00000025380

DomainStartEndE-ValueType
Pfam:Fascin 20 133 4.9e-34 PFAM
Pfam:Fascin 141 254 1.2e-26 PFAM
Pfam:Fascin 266 376 8.9e-35 PFAM
Pfam:Fascin 389 492 4.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000026448
AA Change: V787A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026448
Gene: ENSMUSG00000025384
AA Change: V787A

DomainStartEndE-ValueType
Pfam:FANCAA 447 879 1.4e-196 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154826
Meta Mutation Damage Score 0.1527 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FAAP100 is a component of the Fanconi anemia (FA; MIM 277650) core complex and is required for core complex stability and FANCD2 (see MIM 227646) monoubiquitination (Ling et al., 2007 [PubMed 17396147]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,876 V718A probably damaging Het
Amigo1 A G 3: 108,188,630 S482G probably damaging Het
F2rl3 A G 8: 72,762,751 Q202R probably benign Het
Fat4 A T 3: 38,887,828 Q290L possibly damaging Het
Flnc A G 6: 29,446,344 E920G probably damaging Het
Gm9881 T C 16: 91,170,425 N137S unknown Het
Hps4 A G 5: 112,374,914 E546G probably damaging Het
Htr2b A G 1: 86,110,806 I26T probably benign Het
Insr A C 8: 3,258,841 M65R probably damaging Het
Kif20a T C 18: 34,628,188 probably benign Het
L3mbtl1 A T 2: 162,971,163 probably benign Het
L3mbtl1 A C 2: 162,971,164 probably null Het
Lcn4 T C 2: 26,668,347 I175M probably damaging Het
Malt1 T A 18: 65,475,260 probably null Het
Nufip1 T C 14: 76,111,068 S46P probably damaging Het
Nup93 T A 8: 94,307,943 Y629N probably damaging Het
Olfr517 C A 7: 108,869,150 M1I probably null Het
Pcsk6 T C 7: 66,038,968 probably benign Het
Rdx G C 9: 52,064,860 V33L possibly damaging Het
Rnf213 T C 11: 119,473,480 L4535P probably damaging Het
Rorb T A 19: 18,977,800 T66S probably damaging Het
S100a9 T C 3: 90,692,891 D66G possibly damaging Het
Sacs T C 14: 61,209,265 I2920T probably damaging Het
Safb2 T C 17: 56,575,580 N351S probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Unc13b G A 4: 43,241,164 probably benign Het
Vars A G 17: 34,998,012 S489P probably damaging Het
Wars2 A G 3: 99,216,572 K250E probably damaging Het
Zfp292 A G 4: 34,816,424 probably benign Het
Other mutations in Faap100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Faap100 APN 11 120372132 missense probably damaging 1.00
IGL02954:Faap100 APN 11 120372131 missense probably damaging 1.00
IGL02799:Faap100 UTSW 11 120370735 missense probably damaging 1.00
R0034:Faap100 UTSW 11 120372147 missense probably benign 0.34
R0207:Faap100 UTSW 11 120374365 missense probably damaging 1.00
R0432:Faap100 UTSW 11 120373876 splice site probably benign
R0570:Faap100 UTSW 11 120374288 missense possibly damaging 0.87
R0782:Faap100 UTSW 11 120376704 critical splice donor site probably null
R1218:Faap100 UTSW 11 120378340 missense probably benign 0.06
R1612:Faap100 UTSW 11 120377088 missense probably damaging 1.00
R1720:Faap100 UTSW 11 120374581 missense probably damaging 1.00
R1758:Faap100 UTSW 11 120377233 missense probably damaging 0.99
R2881:Faap100 UTSW 11 120374359 missense probably damaging 1.00
R2893:Faap100 UTSW 11 120374625 missense probably damaging 1.00
R3969:Faap100 UTSW 11 120378705 start codon destroyed probably null 1.00
R4824:Faap100 UTSW 11 120375586 unclassified probably null
R4911:Faap100 UTSW 11 120372113 missense probably benign 0.37
R5152:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5155:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5327:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5328:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5386:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5480:Faap100 UTSW 11 120377113 missense probably damaging 1.00
R5541:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5629:Faap100 UTSW 11 120377011 missense probably damaging 1.00
R5911:Faap100 UTSW 11 120377132 missense possibly damaging 0.94
R6285:Faap100 UTSW 11 120376732 missense probably damaging 1.00
R6350:Faap100 UTSW 11 120374580 missense probably damaging 1.00
R6525:Faap100 UTSW 11 120378764 unclassified probably null
R7046:Faap100 UTSW 11 120377374 missense possibly damaging 0.94
R7539:Faap100 UTSW 11 120377638 missense possibly damaging 0.73
R7781:Faap100 UTSW 11 120374263 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGGCATTATATCCTGTTGCCCAC -3'
(R):5'- CCTTACTTCCTGTCATGGAGCCAAG -3'

Sequencing Primer
(F):5'- GCTGAGGTACCTGTATTCGT -3'
(R):5'- CTTCCTGTCATGGAGCCAAGTATAG -3'
Posted On2013-09-30