Incidental Mutation 'R9262:Krt34'
ID 702334
Institutional Source Beutler Lab
Gene Symbol Krt34
Ensembl Gene ENSMUSG00000043485
Gene Name keratin 34
Synonyms Krt1-4, 4733401E01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9262 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 100037347-100041554 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100040025 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 184 (R184G)
Ref Sequence ENSEMBL: ENSMUSP00000056622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056362]
AlphaFold Q9D646
Predicted Effect probably benign
Transcript: ENSMUST00000056362
AA Change: R184G

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: R184G

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 7.76e-151 SMART
low complexity region 378 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,588 M473V probably benign Het
4933409G03Rik A T 2: 68,613,031 H192L unknown Het
Abca4 T A 3: 122,170,990 C2149S probably damaging Het
Abl2 G A 1: 156,642,250 G1028D possibly damaging Het
Adgre1 A G 17: 57,447,941 T680A probably damaging Het
Amn G A 12: 111,271,151 W10* probably null Het
Ankhd1 G T 18: 36,632,746 V140F Het
Asnsd1 A T 1: 53,344,775 N613K probably benign Het
Bbs2 A T 8: 94,080,915 I417N probably damaging Het
Cad T A 5: 31,067,665 W971R probably null Het
Cand2 A T 6: 115,782,769 I134F probably benign Het
Ccdc154 C A 17: 25,170,186 H453N probably damaging Het
Ccdc7a T A 8: 128,759,796 H1601L possibly damaging Het
Ccdc9 A C 7: 16,278,475 S261A probably benign Het
Cdkl3 T A 11: 52,025,875 S277T probably benign Het
Cipc T A 12: 86,952,723 Y8* probably null Het
Cramp1l A G 17: 25,013,946 S27P probably damaging Het
Csf1r A T 18: 61,110,334 M141L probably benign Het
Csf2rb2 G T 15: 78,284,335 F873L probably damaging Het
Dchs1 G A 7: 105,755,626 R2570W probably damaging Het
Dmxl1 A T 18: 49,843,852 N94Y probably benign Het
Dnajc10 A G 2: 80,346,621 K640R probably benign Het
Epha8 A C 4: 136,931,684 H886Q probably benign Het
Fcgbp G C 7: 28,120,527 D2560H probably damaging Het
Fry T G 5: 150,381,644 F605V probably damaging Het
Fsip2 A G 2: 82,977,318 N1327S probably benign Het
Gm12117 T C 11: 33,276,001 T112A probably benign Het
Gm3604 A T 13: 62,369,883 N220K probably damaging Het
Gm572 T C 4: 148,651,195 V27A probably benign Het
Gm6614 G T 6: 141,980,868 F597L probably damaging Het
Gm8251 A G 1: 44,057,109 S1610P possibly damaging Het
Gm853 A G 4: 130,220,360 V88A possibly damaging Het
Gpr39 A G 1: 125,872,787 K425R probably benign Het
Heatr3 A G 8: 88,156,469 D349G probably benign Het
Hip1 A G 5: 135,449,687 S248P probably damaging Het
Itga11 A G 9: 62,752,396 probably benign Het
Itga3 C T 11: 95,065,799 V210I probably benign Het
Jmjd1c T C 10: 67,248,014 I2173T probably benign Het
Klf13 G A 7: 63,924,708 Q21* probably null Het
Kmt2a A T 9: 44,819,925 S3032T probably benign Het
Krtap16-1 T C 11: 99,986,168 T137A probably benign Het
Mgam T C 6: 40,746,488 probably null Het
Mog T C 17: 37,014,756 T196A possibly damaging Het
Ms4a6d T C 19: 11,601,852 Y87C possibly damaging Het
Ndrg4 C T 8: 95,709,184 probably benign Het
Nsd1 T A 13: 55,247,058 M927K possibly damaging Het
Olfr1246 G T 2: 89,591,091 T8K probably damaging Het
Olfr323 T A 11: 58,625,456 M197L probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcdhac2 A G 18: 37,146,042 R692G possibly damaging Het
Pcsk4 T A 10: 80,325,030 S321C probably damaging Het
Pi4ka A G 16: 17,302,995 F1292L Het
Pigv G T 4: 133,669,799 P6Q possibly damaging Het
Pkhd1 A C 1: 20,548,127 S927A probably benign Het
Pnpla3 A T 15: 84,171,162 I90F probably benign Het
Pole C A 5: 110,325,556 L1739I probably damaging Het
Pole T A 5: 110,325,557 L1739H probably damaging Het
Rbm12 A T 2: 156,097,397 N318K possibly damaging Het
Rpl18a A T 8: 70,895,535 L168Q probably benign Het
Ryr2 T C 13: 11,750,968 N1294S probably damaging Het
Sema5b T C 16: 35,632,853 L98P possibly damaging Het
Smg7 A G 1: 152,845,511 V650A probably damaging Het
Strada C T 11: 106,184,618 R13Q probably damaging Het
Sun1 T C 5: 139,215,163 S37P unknown Het
Syce1l T C 8: 113,654,106 probably null Het
Tdg T A 10: 82,644,673 F263L probably damaging Het
Tead3 G T 17: 28,341,521 S36R probably benign Het
Timm44 A G 8: 4,260,621 L377P probably damaging Het
Tk1 C T 11: 117,825,755 V9M probably benign Het
Trim36 A G 18: 46,167,439 Y722H probably benign Het
Ttn A T 2: 76,809,888 M13792K possibly damaging Het
Unc80 A G 1: 66,555,252 probably benign Het
Usp46 G T 5: 74,029,304 A133E probably benign Het
Wnk2 T A 13: 49,067,954 R1240S probably benign Het
Zfp821 G A 8: 109,724,350 R325Q probably damaging Het
Other mutations in Krt34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Krt34 APN 11 100038694 splice site probably benign
IGL01323:Krt34 APN 11 100038780 missense possibly damaging 0.95
IGL01403:Krt34 APN 11 100038290 missense possibly damaging 0.88
IGL01453:Krt34 APN 11 100040090 missense probably damaging 1.00
IGL02031:Krt34 APN 11 100039023 missense possibly damaging 0.95
IGL02831:Krt34 APN 11 100040147 splice site probably benign
R0024:Krt34 UTSW 11 100041037 missense probably benign 0.01
R0024:Krt34 UTSW 11 100041037 missense probably benign 0.01
R0220:Krt34 UTSW 11 100038693 splice site probably benign
R0242:Krt34 UTSW 11 100041331 missense probably damaging 1.00
R1573:Krt34 UTSW 11 100041028 missense probably benign 0.01
R1714:Krt34 UTSW 11 100040127 missense possibly damaging 0.95
R1879:Krt34 UTSW 11 100038292 missense possibly damaging 0.76
R3084:Krt34 UTSW 11 100041021 missense probably damaging 1.00
R3692:Krt34 UTSW 11 100039031 missense probably damaging 1.00
R3819:Krt34 UTSW 11 100040018 missense probably damaging 1.00
R3872:Krt34 UTSW 11 100041417 missense probably benign
R3876:Krt34 UTSW 11 100040965 missense probably benign 0.02
R6164:Krt34 UTSW 11 100038446 nonsense probably null
R6338:Krt34 UTSW 11 100038490 missense probably benign 0.00
R6457:Krt34 UTSW 11 100040090 missense probably damaging 1.00
R7728:Krt34 UTSW 11 100039985 critical splice donor site probably null
R7748:Krt34 UTSW 11 100038938 missense probably damaging 1.00
R7903:Krt34 UTSW 11 100041495 start codon destroyed probably null 0.42
R8458:Krt34 UTSW 11 100040075 missense probably damaging 1.00
R8480:Krt34 UTSW 11 100040145 critical splice acceptor site probably null
R9514:Krt34 UTSW 11 100038400 missense probably damaging 1.00
Z1176:Krt34 UTSW 11 100041434 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATACAGTGGTAAGGTCCTCCTG -3'
(R):5'- TGGATACGCTCATGGAGTTC -3'

Sequencing Primer
(F):5'- CTCCTGGGTCCTTAGCTTAGAG -3'
(R):5'- ATGGAGTTCTTGGTCCAATACC -3'
Posted On 2022-03-25