Incidental Mutation 'R9262:1700014D04Rik'
ID 702342
Institutional Source Beutler Lab
Gene Symbol 1700014D04Rik
Ensembl Gene ENSMUSG00000051054
Gene Name RIKEN cDNA 1700014D04 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R9262 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 59740842-59746752 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59742588 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 473 (M473V)
Ref Sequence ENSEMBL: ENSMUSP00000136424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055343] [ENSMUST00000178508] [ENSMUST00000180139]
AlphaFold J3QMS2
Predicted Effect probably benign
Transcript: ENSMUST00000055343
AA Change: M55V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000052403
Gene: ENSMUSG00000051054
AA Change: M55V

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178508
SMART Domains Protein: ENSMUSP00000136897
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
Pfam:FAM75 66 99 7.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180139
AA Change: M473V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000136424
Gene: ENSMUSG00000051054
AA Change: M473V

DomainStartEndE-ValueType
Pfam:FAM75 66 439 6.9e-97 PFAM
low complexity region 622 633 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
low complexity region 737 763 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,613,031 H192L unknown Het
Abca4 T A 3: 122,170,990 C2149S probably damaging Het
Abl2 G A 1: 156,642,250 G1028D possibly damaging Het
Adgre1 A G 17: 57,447,941 T680A probably damaging Het
Amn G A 12: 111,271,151 W10* probably null Het
Ankhd1 G T 18: 36,632,746 V140F Het
Asnsd1 A T 1: 53,344,775 N613K probably benign Het
Bbs2 A T 8: 94,080,915 I417N probably damaging Het
Cad T A 5: 31,067,665 W971R probably null Het
Cand2 A T 6: 115,782,769 I134F probably benign Het
Ccdc154 C A 17: 25,170,186 H453N probably damaging Het
Ccdc7a T A 8: 128,759,796 H1601L possibly damaging Het
Ccdc9 A C 7: 16,278,475 S261A probably benign Het
Cdkl3 T A 11: 52,025,875 S277T probably benign Het
Cipc T A 12: 86,952,723 Y8* probably null Het
Cramp1l A G 17: 25,013,946 S27P probably damaging Het
Csf1r A T 18: 61,110,334 M141L probably benign Het
Csf2rb2 G T 15: 78,284,335 F873L probably damaging Het
Dchs1 G A 7: 105,755,626 R2570W probably damaging Het
Dmxl1 A T 18: 49,843,852 N94Y probably benign Het
Dnajc10 A G 2: 80,346,621 K640R probably benign Het
Epha8 A C 4: 136,931,684 H886Q probably benign Het
Fcgbp G C 7: 28,120,527 D2560H probably damaging Het
Fry T G 5: 150,381,644 F605V probably damaging Het
Fsip2 A G 2: 82,977,318 N1327S probably benign Het
Gm12117 T C 11: 33,276,001 T112A probably benign Het
Gm3604 A T 13: 62,369,883 N220K probably damaging Het
Gm572 T C 4: 148,651,195 V27A probably benign Het
Gm6614 G T 6: 141,980,868 F597L probably damaging Het
Gm8251 A G 1: 44,057,109 S1610P possibly damaging Het
Gm853 A G 4: 130,220,360 V88A possibly damaging Het
Gpr39 A G 1: 125,872,787 K425R probably benign Het
Heatr3 A G 8: 88,156,469 D349G probably benign Het
Hip1 A G 5: 135,449,687 S248P probably damaging Het
Itga3 C T 11: 95,065,799 V210I probably benign Het
Jmjd1c T C 10: 67,248,014 I2173T probably benign Het
Klf13 G A 7: 63,924,708 Q21* probably null Het
Kmt2a A T 9: 44,819,925 S3032T probably benign Het
Krt34 T C 11: 100,040,025 R184G probably benign Het
Krtap16-1 T C 11: 99,986,168 T137A probably benign Het
Mgam T C 6: 40,746,488 probably null Het
Mog T C 17: 37,014,756 T196A possibly damaging Het
Ms4a6d T C 19: 11,601,852 Y87C possibly damaging Het
Nsd1 T A 13: 55,247,058 M927K possibly damaging Het
Olfr1246 G T 2: 89,591,091 T8K probably damaging Het
Olfr323 T A 11: 58,625,456 M197L probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcdhac2 A G 18: 37,146,042 R692G possibly damaging Het
Pcsk4 T A 10: 80,325,030 S321C probably damaging Het
Pi4ka A G 16: 17,302,995 F1292L Het
Pigv G T 4: 133,669,799 P6Q possibly damaging Het
Pkhd1 A C 1: 20,548,127 S927A probably benign Het
Pnpla3 A T 15: 84,171,162 I90F probably benign Het
Pole C A 5: 110,325,556 L1739I probably damaging Het
Pole T A 5: 110,325,557 L1739H probably damaging Het
Rbm12 A T 2: 156,097,397 N318K possibly damaging Het
Rpl18a A T 8: 70,895,535 L168Q probably benign Het
Ryr2 T C 13: 11,750,968 N1294S probably damaging Het
Sema5b T C 16: 35,632,853 L98P possibly damaging Het
Smg7 A G 1: 152,845,511 V650A probably damaging Het
Strada C T 11: 106,184,618 R13Q probably damaging Het
Sun1 T C 5: 139,215,163 S37P unknown Het
Syce1l T C 8: 113,654,106 probably null Het
Tdg T A 10: 82,644,673 F263L probably damaging Het
Tead3 G T 17: 28,341,521 S36R probably benign Het
Timm44 A G 8: 4,260,621 L377P probably damaging Het
Tk1 C T 11: 117,825,755 V9M probably benign Het
Trim36 A G 18: 46,167,439 Y722H probably benign Het
Ttn A T 2: 76,809,888 M13792K possibly damaging Het
Usp46 G T 5: 74,029,304 A133E probably benign Het
Wnk2 T A 13: 49,067,954 R1240S probably benign Het
Zfp821 G A 8: 109,724,350 R325Q probably damaging Het
Other mutations in 1700014D04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB010:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
BB020:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
R0838:1700014D04Rik UTSW 13 59742468 missense possibly damaging 0.75
R1483:1700014D04Rik UTSW 13 59742903 missense probably damaging 0.99
R1794:1700014D04Rik UTSW 13 59742620 missense probably benign 0.22
R1842:1700014D04Rik UTSW 13 59742506 missense probably damaging 1.00
R1969:1700014D04Rik UTSW 13 59742785 missense probably damaging 0.98
R2027:1700014D04Rik UTSW 13 59742587 missense possibly damaging 0.48
R2206:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2207:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2882:1700014D04Rik UTSW 13 59742943 missense probably benign 0.00
R3508:1700014D04Rik UTSW 13 59742505 nonsense probably null
R4447:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R4560:1700014D04Rik UTSW 13 59741757 missense probably damaging 1.00
R4846:1700014D04Rik UTSW 13 59742233 missense probably benign 0.00
R5186:1700014D04Rik UTSW 13 59743739 missense probably damaging 1.00
R5510:1700014D04Rik UTSW 13 59742420 splice site probably null
R5580:1700014D04Rik UTSW 13 59742256 missense probably benign 0.00
R5752:1700014D04Rik UTSW 13 59743202 missense probably damaging 0.96
R6266:1700014D04Rik UTSW 13 59742312 missense probably benign 0.33
R6267:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6296:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6939:1700014D04Rik UTSW 13 59742058 missense possibly damaging 0.75
R6973:1700014D04Rik UTSW 13 59742707 missense probably benign 0.14
R7107:1700014D04Rik UTSW 13 59742183 nonsense probably null
R7123:1700014D04Rik UTSW 13 59743440 nonsense probably null
R7254:1700014D04Rik UTSW 13 59741976 missense probably benign 0.01
R7354:1700014D04Rik UTSW 13 59741834 nonsense probably null
R7536:1700014D04Rik UTSW 13 59741742 missense probably damaging 0.99
R7729:1700014D04Rik UTSW 13 59741623 missense not run
R7912:1700014D04Rik UTSW 13 59742515 missense probably damaging 1.00
R7933:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
R8029:1700014D04Rik UTSW 13 59742377 missense possibly damaging 0.79
R8347:1700014D04Rik UTSW 13 59742236 missense possibly damaging 0.63
R8370:1700014D04Rik UTSW 13 59743952 missense probably benign
R8395:1700014D04Rik UTSW 13 59741726 missense probably benign 0.00
R8508:1700014D04Rik UTSW 13 59743598 missense probably benign 0.02
R8930:1700014D04Rik UTSW 13 59742201 missense possibly damaging 0.76
R8932:1700014D04Rik UTSW 13 59742201 missense possibly damaging 0.76
R9127:1700014D04Rik UTSW 13 59743014 missense probably benign 0.00
R9401:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R9514:1700014D04Rik UTSW 13 59742992 missense probably damaging 0.96
X0024:1700014D04Rik UTSW 13 59742725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGAGAAGGTCGGAGCTTC -3'
(R):5'- ACATGAGAAGCATTCTGAGGTTG -3'

Sequencing Primer
(F):5'- GACTGGGAAAGTTACTTTTCAAATCC -3'
(R):5'- CATTCTGAGGTTGCACATGAGCAG -3'
Posted On 2022-03-25