Incidental Mutation 'R9263:Sirpb1a'
ID 702369
Institutional Source Beutler Lab
Gene Symbol Sirpb1a
Ensembl Gene ENSMUSG00000095788
Gene Name signal-regulatory protein beta 1A
Synonyms 9930027N05Rik, Sirpb1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R9263 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 15436887-15491487 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15481992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 112 (D112G)
Ref Sequence ENSEMBL: ENSMUSP00000141504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099201] [ENSMUST00000192700] [ENSMUST00000194144]
AlphaFold A0A0A6YYP6
Predicted Effect probably damaging
Transcript: ENSMUST00000099201
AA Change: D112G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096807
Gene: ENSMUSG00000095788
AA Change: D112G

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192700
AA Change: D112G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141504
Gene: ENSMUSG00000095788
AA Change: D112G

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194144
AA Change: D45G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141659
Gene: ENSMUSG00000095788
AA Change: D45G

DomainStartEndE-ValueType
Pfam:Ig_2 15 66 6.6e-1 PFAM
Pfam:Ig_3 21 52 1.7e-2 PFAM
Pfam:V-set 23 75 1.2e-7 PFAM
IGc1 96 169 4.8e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c14 T C 13: 4,113,620 (GRCm39) S51P probably damaging Het
Arhgef38 T G 3: 132,866,529 (GRCm39) K203Q Het
Cacna1d G A 14: 29,796,925 (GRCm39) R1517W probably damaging Het
Ccdc80 T A 16: 44,915,949 (GRCm39) M235K probably damaging Het
Cdc42bpg T C 19: 6,372,149 (GRCm39) S1414P probably damaging Het
Dab2ip A G 2: 35,602,891 (GRCm39) D395G probably damaging Het
Dmxl2 T C 9: 54,358,945 (GRCm39) E255G probably benign Het
Dnaja1 T A 4: 40,724,133 (GRCm39) M98K probably benign Het
Dnajb7 G A 15: 81,292,266 (GRCm39) R24C probably benign Het
Dscc1 C A 15: 54,947,505 (GRCm39) W225L probably damaging Het
Dsg2 T A 18: 20,727,223 (GRCm39) V590D probably benign Het
Epcam A G 17: 87,947,960 (GRCm39) probably benign Het
Fbn2 T C 18: 58,257,344 (GRCm39) Y341C probably damaging Het
Fry T G 5: 150,322,728 (GRCm39) L1040R probably damaging Het
Gm9639 C T 10: 77,630,828 (GRCm39) C28Y unknown Het
Hsd17b7 A G 1: 169,794,833 (GRCm39) S69P probably damaging Het
Igsf1 A G X: 48,884,191 (GRCm39) M2T possibly damaging Het
Katnip T A 7: 125,469,867 (GRCm39) D1445E probably damaging Het
Kmt2d TGCTGCTGCTGCTGCTGCTGG TG 15: 98,747,499 (GRCm39) probably null Het
Lrp5 T C 19: 3,654,190 (GRCm39) Y1079C probably damaging Het
Lrp6 T C 6: 134,457,467 (GRCm39) D779G probably damaging Het
Nbea AC A 3: 55,998,393 (GRCm39) probably null Het
Pacsin1 A G 17: 27,923,924 (GRCm39) D106G probably damaging Het
Pcm1 T A 8: 41,732,790 (GRCm39) D682E probably benign Het
Pex6 A G 17: 47,023,231 (GRCm39) D269G probably benign Het
Rcor1 T A 12: 111,078,327 (GRCm39) V474E Het
Rdh16 A G 10: 127,649,306 (GRCm39) D254G probably benign Het
Rp1 A T 1: 4,418,675 (GRCm39) D812E probably benign Het
Rp1 A G 1: 4,419,160 (GRCm39) S651P probably benign Het
Sec16b G A 1: 157,359,748 (GRCm39) probably benign Het
Sephs2 C T 7: 126,872,122 (GRCm39) G324S probably damaging Het
Slc25a47 C G 12: 108,820,215 (GRCm39) T73S probably benign Het
Slco4c1 A T 1: 96,799,509 (GRCm39) L109H probably damaging Het
Smc2 A G 4: 52,470,848 (GRCm39) E845G possibly damaging Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Suz12 A G 11: 79,904,087 (GRCm39) probably benign Het
Sycp2 A G 2: 178,035,931 (GRCm39) I252T probably damaging Het
Syne3 T C 12: 104,934,415 (GRCm39) Y118C probably damaging Het
Tbx18 C A 9: 87,611,521 (GRCm39) A170S probably damaging Het
Trak2 T C 1: 58,985,481 (GRCm39) N6D probably benign Het
Ttn G A 2: 76,720,868 (GRCm39) T6852I unknown Het
Tufm A G 7: 126,088,100 (GRCm39) E201G probably damaging Het
Vwa3b C A 1: 37,099,493 (GRCm39) P236Q probably benign Het
Xirp2 A G 2: 67,345,289 (GRCm39) Y2510C possibly damaging Het
Other mutations in Sirpb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Sirpb1a APN 3 15,475,788 (GRCm39) unclassified probably benign
IGL00597:Sirpb1a APN 3 15,481,977 (GRCm39) missense probably damaging 1.00
IGL01521:Sirpb1a APN 3 15,475,561 (GRCm39) missense probably benign 0.00
IGL01678:Sirpb1a APN 3 15,476,370 (GRCm39) missense probably damaging 1.00
IGL02154:Sirpb1a APN 3 15,475,504 (GRCm39) missense probably damaging 1.00
IGL02275:Sirpb1a APN 3 15,475,469 (GRCm39) critical splice donor site probably null
IGL02419:Sirpb1a APN 3 15,491,398 (GRCm39) missense probably benign
IGL02657:Sirpb1a APN 3 15,482,111 (GRCm39) missense possibly damaging 0.85
IGL03086:Sirpb1a APN 3 15,491,388 (GRCm39) splice site probably null
PIT4142001:Sirpb1a UTSW 3 15,476,258 (GRCm39) missense probably benign 0.00
R0270:Sirpb1a UTSW 3 15,475,587 (GRCm39) missense probably damaging 1.00
R1975:Sirpb1a UTSW 3 15,444,141 (GRCm39) missense probably benign 0.00
R3432:Sirpb1a UTSW 3 15,491,447 (GRCm39) missense probably damaging 0.98
R4613:Sirpb1a UTSW 3 15,482,097 (GRCm39) missense probably benign 0.09
R5325:Sirpb1a UTSW 3 15,476,503 (GRCm39) missense possibly damaging 0.90
R6223:Sirpb1a UTSW 3 15,444,086 (GRCm39) missense probably benign 0.02
R6526:Sirpb1a UTSW 3 15,444,080 (GRCm39) missense probably damaging 0.99
R6903:Sirpb1a UTSW 3 15,481,984 (GRCm39) missense probably damaging 0.99
R7349:Sirpb1a UTSW 3 15,475,664 (GRCm39) missense probably damaging 0.99
R7513:Sirpb1a UTSW 3 15,476,503 (GRCm39) missense possibly damaging 0.90
R8250:Sirpb1a UTSW 3 15,444,104 (GRCm39) missense possibly damaging 0.92
R8700:Sirpb1a UTSW 3 15,476,419 (GRCm39) missense probably damaging 0.97
R9553:Sirpb1a UTSW 3 15,476,320 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAGGTTCTTTGGTCCAGAG -3'
(R):5'- AGCCACTCTAAACTGCACAGTG -3'

Sequencing Primer
(F):5'- GGTCCAGAGTTATGATAAAGTAAACC -3'
(R):5'- TGCACAGTGACATCCCTCC -3'
Posted On 2022-03-25