Mutagenetix > Incidental Mutation

Incidental Mutation 'R9263:Sstr3'

702390

Institutional Source

Beutler Lab

Gene Symbol

Sstr3

Ensembl Gene

ENSMUSG00000044933

Gene Name

somatostatin receptor 3

Synonyms

Smstr-3, Smstr3, sst3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9263 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78421208-78428885 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 78423792 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 318 (N318K)

Ref Sequence

ENSEMBL: ENSMUSP00000058040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053239] [ENSMUST00000230400]

AlphaFold

P30935

Predicted Effect

probably damaging
Transcript: ENSMUST00000053239
AA Change: N318K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058040
Gene: ENSMUSG00000044933
AA Change: N318K

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	53	291	1.9e-8	PFAM
Pfam:7TM_GPCR_Srsx	56	337	3.5e-15	PFAM
Pfam:7tm_1	62	322	6.3e-60	PFAM
Pfam:7TM_GPCR_Srv	121	337	9.5e-8	PFAM
coiled coil region	355	388	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000230400

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c14	T	C	13: 4,113,620 (GRCm39)	S51P	probably damaging	Het
Arhgef38	T	G	3: 132,866,529 (GRCm39)	K203Q		Het
Cacna1d	G	A	14: 29,796,925 (GRCm39)	R1517W	probably damaging	Het
Ccdc80	T	A	16: 44,915,949 (GRCm39)	M235K	probably damaging	Het
Cdc42bpg	T	C	19: 6,372,149 (GRCm39)	S1414P	probably damaging	Het
Dab2ip	A	G	2: 35,602,891 (GRCm39)	D395G	probably damaging	Het
Dmxl2	T	C	9: 54,358,945 (GRCm39)	E255G	probably benign	Het
Dnaja1	T	A	4: 40,724,133 (GRCm39)	M98K	probably benign	Het
Dnajb7	G	A	15: 81,292,266 (GRCm39)	R24C	probably benign	Het
Dscc1	C	A	15: 54,947,505 (GRCm39)	W225L	probably damaging	Het
Dsg2	T	A	18: 20,727,223 (GRCm39)	V590D	probably benign	Het
Epcam	A	G	17: 87,947,960 (GRCm39)		probably benign	Het
Fbn2	T	C	18: 58,257,344 (GRCm39)	Y341C	probably damaging	Het
Fry	T	G	5: 150,322,728 (GRCm39)	L1040R	probably damaging	Het
Gm9639	C	T	10: 77,630,828 (GRCm39)	C28Y	unknown	Het
Hsd17b7	A	G	1: 169,794,833 (GRCm39)	S69P	probably damaging	Het
Igsf1	A	G	X: 48,884,191 (GRCm39)	M2T	possibly damaging	Het
Katnip	T	A	7: 125,469,867 (GRCm39)	D1445E	probably damaging	Het
Kmt2d	TGCTGCTGCTGCTGCTGCTGG	TG	15: 98,747,499 (GRCm39)		probably null	Het
Lrp5	T	C	19: 3,654,190 (GRCm39)	Y1079C	probably damaging	Het
Lrp6	T	C	6: 134,457,467 (GRCm39)	D779G	probably damaging	Het
Nbea	AC	A	3: 55,998,393 (GRCm39)		probably null	Het
Pacsin1	A	G	17: 27,923,924 (GRCm39)	D106G	probably damaging	Het
Pcm1	T	A	8: 41,732,790 (GRCm39)	D682E	probably benign	Het
Pex6	A	G	17: 47,023,231 (GRCm39)	D269G	probably benign	Het
Rcor1	T	A	12: 111,078,327 (GRCm39)	V474E		Het
Rdh16	A	G	10: 127,649,306 (GRCm39)	D254G	probably benign	Het
Rp1	A	T	1: 4,418,675 (GRCm39)	D812E	probably benign	Het
Rp1	A	G	1: 4,419,160 (GRCm39)	S651P	probably benign	Het
Sec16b	G	A	1: 157,359,748 (GRCm39)		probably benign	Het
Sephs2	C	T	7: 126,872,122 (GRCm39)	G324S	probably damaging	Het
Sirpb1a	T	C	3: 15,481,992 (GRCm39)	D112G	probably damaging	Het
Slc25a47	C	G	12: 108,820,215 (GRCm39)	T73S	probably benign	Het
Slco4c1	A	T	1: 96,799,509 (GRCm39)	L109H	probably damaging	Het
Smc2	A	G	4: 52,470,848 (GRCm39)	E845G	possibly damaging	Het
Suz12	A	G	11: 79,904,087 (GRCm39)		probably benign	Het
Sycp2	A	G	2: 178,035,931 (GRCm39)	I252T	probably damaging	Het
Syne3	T	C	12: 104,934,415 (GRCm39)	Y118C	probably damaging	Het
Tbx18	C	A	9: 87,611,521 (GRCm39)	A170S	probably damaging	Het
Trak2	T	C	1: 58,985,481 (GRCm39)	N6D	probably benign	Het
Ttn	G	A	2: 76,720,868 (GRCm39)	T6852I	unknown	Het
Tufm	A	G	7: 126,088,100 (GRCm39)	E201G	probably damaging	Het
Vwa3b	C	A	1: 37,099,493 (GRCm39)	P236Q	probably benign	Het
Xirp2	A	G	2: 67,345,289 (GRCm39)	Y2510C	possibly damaging	Het

Other mutations in Sstr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sstr3	APN	15	78,424,667 (GRCm39)	missense	probably benign	0.00
R0442:Sstr3	UTSW	15	78,424,597 (GRCm39)	missense	probably damaging	0.99
R1714:Sstr3	UTSW	15	78,424,473 (GRCm39)	missense	probably damaging	1.00
R1865:Sstr3	UTSW	15	78,424,168 (GRCm39)	missense	probably damaging	1.00
R2008:Sstr3	UTSW	15	78,424,711 (GRCm39)	missense	probably benign	0.14
R2351:Sstr3	UTSW	15	78,424,121 (GRCm39)	missense	probably benign	0.01
R3023:Sstr3	UTSW	15	78,424,187 (GRCm39)	missense	probably damaging	0.99
R3024:Sstr3	UTSW	15	78,424,187 (GRCm39)	missense	probably damaging	0.99
R3770:Sstr3	UTSW	15	78,424,577 (GRCm39)	missense	probably damaging	1.00
R4399:Sstr3	UTSW	15	78,424,324 (GRCm39)	missense	probably damaging	1.00
R4724:Sstr3	UTSW	15	78,423,897 (GRCm39)	nonsense	probably null
R6181:Sstr3	UTSW	15	78,423,661 (GRCm39)	missense	probably benign
R6247:Sstr3	UTSW	15	78,423,788 (GRCm39)	missense	probably damaging	0.99
R7450:Sstr3	UTSW	15	78,424,043 (GRCm39)	missense	probably damaging	1.00
R7578:Sstr3	UTSW	15	78,424,717 (GRCm39)	missense	probably benign
R7793:Sstr3	UTSW	15	78,424,588 (GRCm39)	missense	probably damaging	1.00
R8336:Sstr3	UTSW	15	78,424,693 (GRCm39)	missense	probably damaging	1.00
R9264:Sstr3	UTSW	15	78,423,792 (GRCm39)	missense	probably damaging	1.00
R9265:Sstr3	UTSW	15	78,423,792 (GRCm39)	missense	probably damaging	1.00
X0026:Sstr3	UTSW	15	78,423,574 (GRCm39)	missense	possibly damaging	0.57
Z1177:Sstr3	UTSW	15	78,423,503 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCTGTTGTCCACTAGTGC -3'
(R):5'- CTCATTGTGGTAAAGGTGCG -3'

Sequencing Primer
(F):5'- TGTGCGATCTGACTGAGCCTC -3'
(R):5'- TAAAGGTGCGGTCGACCAC -3'

Posted On

2022-03-25