Mutagenetix > Incidental Mutation

Incidental Mutation 'R9264:Optc'

702402

Institutional Source

Beutler Lab

Gene Symbol

Optc

Ensembl Gene

ENSMUSG00000010311

Gene Name

opticin

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

133897199-133907999 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 133905240 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 41 (I41V)

Ref Sequence

ENSEMBL: ENSMUSP00000120568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124051] [ENSMUST00000149380] [ENSMUST00000153617]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000124051
AA Change: I41V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000120568
Gene: ENSMUSG00000010311
AA Change: I41V

Domain	Start	End	E-Value	Type
low complexity region	42	70	N/A	INTRINSIC
low complexity region	78	88	N/A	INTRINSIC
low complexity region	134	145	N/A	INTRINSIC
LRRNT	176	206	2.22e-2	SMART
LRR	200	224	3.55e1	SMART
LRR_TYP	225	248	6.78e-3	SMART
LRR	249	271	4.21e1	SMART
LRR	295	318	1.76e1	SMART
LRR	319	339	3.36e1	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000117086
Gene: ENSMUSG00000010311
AA Change: I30V

Domain	Start	End	E-Value	Type
low complexity region	32	60	N/A	INTRINSIC
low complexity region	68	78	N/A	INTRINSIC
low complexity region	124	135	N/A	INTRINSIC
LRRNT	166	196	2.22e-2	SMART
LRR	190	214	3.55e1	SMART
LRR_TYP	215	238	6.78e-3	SMART
LRR	239	261	4.21e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149380
AA Change: I41V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000115661
Gene: ENSMUSG00000010311
AA Change: I41V

Domain	Start	End	E-Value	Type
low complexity region	42	70	N/A	INTRINSIC
low complexity region	78	88	N/A	INTRINSIC
low complexity region	134	145	N/A	INTRINSIC
LRR	173	195	1.22e1	SMART
LRR	196	218	4.21e1	SMART
LRR	242	265	1.76e1	SMART
LRR	266	286	3.36e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000153617
AA Change: I41V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000123262
Gene: ENSMUSG00000010311
AA Change: I41V

Domain	Start	End	E-Value	Type
low complexity region	42	70	N/A	INTRINSIC
low complexity region	78	88	N/A	INTRINSIC
low complexity region	134	145	N/A	INTRINSIC
LRR	173	195	1.22e1	SMART
LRR	196	218	4.21e1	SMART
LRR	242	265	1.76e1	SMART
LRR	266	286	3.36e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opticin belongs to class III of the small leucine-rich repeat protein (SLRP) family. Members of this family are typically associated with the extracellular matrix. Opticin is present in significant quantities in the vitreous of the eye and also localizes to the cornea, iris, ciliary body, optic nerve, choroid, retina, and fetal liver. Opticin may noncovalently bind collagen fibrils and regulate fibril morphology, spacing, and organization. The opticin gene is mapped to a region of chromosome 1 that is associated with the inherited eye diseases age-related macular degeneration (AMD) and posterior column ataxia with retinosa pigmentosa (AXPC1). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased preretinal neovascularization in an oxygen-induced retinopathy model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,116,466	M1L	probably benign	Het
Abca15	A	T	7: 120,401,833	I1531L	probably benign	Het
Adam28	T	C	14: 68,607,465	Y791C	probably benign	Het
Ankrd40	T	A	11: 94,338,361	I262N	probably damaging	Het
BC067074	G	A	13: 113,319,480	V687M		Het
Catsperg2	A	T	7: 29,698,188	N1033K	possibly damaging	Het
Cdh10	A	T	15: 18,963,995	D81V	probably damaging	Het
Cep290	T	C	10: 100,498,016	V310A	possibly damaging	Het
Cep78	T	C	19: 15,974,466	Y325C	probably damaging	Het
Clstn3	T	A	6: 124,459,768	D197V	probably damaging	Het
Col11a1	T	C	3: 114,212,160	I1647T	unknown	Het
Col5a1	G	A	2: 27,964,111	R569K	unknown	Het
Cyp4a10	T	C	4: 115,524,278	S180P	probably benign	Het
D630045J12Rik	T	C	6: 38,158,238	I1336V	probably benign	Het
Dchs2	G	A	3: 83,270,477	V946M	probably damaging	Het
Dnah10	A	G	5: 124,736,836	R347G	probably damaging	Het
Dnah11	T	A	12: 118,027,527	D2368V	probably damaging	Het
Ganab	T	C	19: 8,912,864	I719T	possibly damaging	Het
Gm10944	C	A	10: 10,681,839	A11D	unknown	Het
Gmcl1	T	C	6: 86,714,213	M267V	probably benign	Het
Inhbe	T	A	10: 127,350,558	D251V	probably damaging	Het
Kcnj1	G	A	9: 32,396,358	R26Q	probably benign	Het
Lama5	A	G	2: 180,196,478		probably benign	Het
Lin9	T	A	1: 180,667,347	D251E	probably damaging	Het
Magel2	T	A	7: 62,378,596	I416N	possibly damaging	Het
Mdga2	T	C	12: 66,513,283	N772S	probably damaging	Het
Msh3	G	T	13: 92,349,304	Q171K	probably benign	Het
Mslnl	T	G	17: 25,742,532		probably benign	Het
Mtpn	A	G	6: 35,512,241	L116P	possibly damaging	Het
Myh7	T	C	14: 54,975,997	T1351A	probably benign	Het
Nectin3	A	T	16: 46,454,635	I353N	probably damaging	Het
Nprl3	A	T	11: 32,233,948	N500K	probably benign	Het
Nup93	T	A	8: 94,292,720	I181N	probably benign	Het
Olfr1198	T	C	2: 88,746,432	H152R	probably damaging	Het
Olfr362	G	A	2: 37,104,789	T287I	probably damaging	Het
Pcdh7	C	A	5: 58,129,321	N1246K	probably benign	Het
Pcdhb3	T	A	18: 37,302,113	D377E	probably benign	Het
Pnpla6	C	T	8: 3,523,294	P386L	probably benign	Het
Polr3a	T	C	14: 24,470,831	T587A	probably benign	Het
Pramel1	T	G	4: 143,398,529	L341R	probably damaging	Het
Rhot2	A	T	17: 25,841,766	N210K	probably damaging	Het
Slc37a1	A	G	17: 31,300,485	I12V	probably benign	Het
Spata48	T	A	11: 11,464,678	D141E		Het
Sstr3	G	T	15: 78,539,592	N318K	probably damaging	Het
Ssx2ip	T	C	3: 146,437,200	V511A	probably benign	Het
Stfa1	G	A	16: 36,280,568	V57I	unknown	Het
Syne1	T	G	10: 5,262,793	R3265S	probably damaging	Het
Tacc2	G	T	7: 130,626,803	K1739N	probably damaging	Het
Tas2r143	A	T	6: 42,400,739	M168L	probably benign	Het
Tm4sf1	A	T	3: 57,294,610		probably null	Het
Ttc16	A	G	2: 32,763,005	I604T	possibly damaging	Het
Ugt1a10	T	A	1: 88,055,671	W64R	possibly damaging	Het
Usp34	A	T	11: 23,489,064	H3561L		Het
Vasp	C	T	7: 19,259,451	V276I	unknown	Het
Vwa3a	A	G	7: 120,775,464	N333S	probably benign	Het
Wipf3	A	G	6: 54,483,881	N105D	probably benign	Het
Zfp760	T	C	17: 21,723,682	S613P	possibly damaging	Het

Other mutations in Optc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Optc	APN	1	133902108	missense	probably damaging	1.00
IGL01900:Optc	APN	1	133902129	missense	possibly damaging	0.68
IGL01988:Optc	APN	1	133906929	critical splice donor site	probably null
IGL02070:Optc	APN	1	133901176	missense	probably damaging	1.00
IGL02859:Optc	APN	1	133902061	missense	probably damaging	1.00
IGL03166:Optc	APN	1	133903792	splice site	probably benign
R0826:Optc	UTSW	1	133905155	missense	probably benign	0.07
R1728:Optc	UTSW	1	133903796	splice site	probably null
R1728:Optc	UTSW	1	133905170	missense	probably benign
R1729:Optc	UTSW	1	133903796	splice site	probably null
R1729:Optc	UTSW	1	133905170	missense	probably benign
R1730:Optc	UTSW	1	133903796	splice site	probably null
R1730:Optc	UTSW	1	133905170	missense	probably benign
R1739:Optc	UTSW	1	133903796	splice site	probably null
R1739:Optc	UTSW	1	133905170	missense	probably benign
R1762:Optc	UTSW	1	133903796	splice site	probably null
R1762:Optc	UTSW	1	133905170	missense	probably benign
R1783:Optc	UTSW	1	133903796	splice site	probably null
R1783:Optc	UTSW	1	133905170	missense	probably benign
R1784:Optc	UTSW	1	133903796	splice site	probably null
R1784:Optc	UTSW	1	133905170	missense	probably benign
R1785:Optc	UTSW	1	133903796	splice site	probably null
R1785:Optc	UTSW	1	133905170	missense	probably benign
R2049:Optc	UTSW	1	133903796	splice site	probably null
R2130:Optc	UTSW	1	133903796	splice site	probably null
R2131:Optc	UTSW	1	133903796	splice site	probably null
R2133:Optc	UTSW	1	133903796	splice site	probably null
R2141:Optc	UTSW	1	133903796	splice site	probably null
R2142:Optc	UTSW	1	133903796	splice site	probably null
R3436:Optc	UTSW	1	133897879	missense	probably damaging	1.00
R3437:Optc	UTSW	1	133897879	missense	probably damaging	1.00
R3711:Optc	UTSW	1	133905081	missense	probably benign	0.15
R3902:Optc	UTSW	1	133897963	missense	probably benign	0.10
R3930:Optc	UTSW	1	133901182	nonsense	probably null
R4078:Optc	UTSW	1	133898349	missense	probably damaging	1.00
R4523:Optc	UTSW	1	133903754	missense	possibly damaging	0.94
R4672:Optc	UTSW	1	133897817	missense	possibly damaging	0.48
R5113:Optc	UTSW	1	133900977	splice site	probably benign
R5176:Optc	UTSW	1	133902084	missense	probably benign	0.00
R5530:Optc	UTSW	1	133905090	missense	probably benign	0.01
R5692:Optc	UTSW	1	133900976	splice site	probably benign
R5819:Optc	UTSW	1	133897879	missense	probably damaging	1.00
R6208:Optc	UTSW	1	133904999	missense	probably damaging	1.00
R6828:Optc	UTSW	1	133897867	missense	probably damaging	1.00
R6859:Optc	UTSW	1	133897816	missense	possibly damaging	0.95
R6986:Optc	UTSW	1	133897964	missense	probably benign	0.00
R7349:Optc	UTSW	1	133897879	missense	probably damaging	1.00
R7754:Optc	UTSW	1	133906992	missense	possibly damaging	0.73
R8270:Optc	UTSW	1	133905072	missense	probably benign	0.02
R8801:Optc	UTSW	1	133905081	missense	possibly damaging	0.47
R8966:Optc	UTSW	1	133901134	missense	probably damaging	0.96
R9309:Optc	UTSW	1	133897944	missense	probably benign
X0025:Optc	UTSW	1	133897911	missense	probably damaging	1.00
Z1177:Optc	UTSW	1	133901085	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- AATGACCTCGTTGTAGTCCTC -3'
(R):5'- GATACCTCCAGATACAGACCGG -3'

Sequencing Primer
(F):5'- AGGGTATGGTTCCCCACATACAG -3'
(R):5'- TCCAGATACAGACCGGACTTTAAAG -3'

Posted On

2022-03-25