Incidental Mutation 'R9264:Or4p23'
ID 702407
Institutional Source Beutler Lab
Gene Symbol Or4p23
Ensembl Gene ENSMUSG00000075117
Gene Name olfactory receptor family 4 subfamily P member 23
Synonyms GA_x6K02T2Q125-50221692-50220766, MOR225-13, Olfr1198
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 88576304-88577230 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88576776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 152 (H152R)
Ref Sequence ENSEMBL: ENSMUSP00000149844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099814] [ENSMUST00000215179] [ENSMUST00000215529]
AlphaFold Q7TR12
Predicted Effect probably damaging
Transcript: ENSMUST00000099814
AA Change: H152R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097402
Gene: ENSMUSG00000075117
AA Change: H152R

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.1e-49 PFAM
Pfam:7tm_1 38 284 1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215179
AA Change: H152R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215529
AA Change: H152R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8537 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Or4p23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02290:Or4p23 APN 2 88,576,729 (GRCm39) missense probably benign
IGL02316:Or4p23 APN 2 88,577,187 (GRCm39) missense probably damaging 0.97
R0726:Or4p23 UTSW 2 88,576,352 (GRCm39) missense probably benign 0.15
R1439:Or4p23 UTSW 2 88,577,178 (GRCm39) missense possibly damaging 0.57
R1706:Or4p23 UTSW 2 88,576,482 (GRCm39) missense probably damaging 1.00
R1757:Or4p23 UTSW 2 88,576,361 (GRCm39) missense probably benign 0.15
R2202:Or4p23 UTSW 2 88,576,953 (GRCm39) missense probably benign 0.00
R2203:Or4p23 UTSW 2 88,576,953 (GRCm39) missense probably benign 0.00
R2204:Or4p23 UTSW 2 88,576,953 (GRCm39) missense probably benign 0.00
R3085:Or4p23 UTSW 2 88,576,488 (GRCm39) missense probably damaging 1.00
R4901:Or4p23 UTSW 2 88,577,231 (GRCm39) splice site probably null
R4934:Or4p23 UTSW 2 88,576,398 (GRCm39) nonsense probably null
R5687:Or4p23 UTSW 2 88,577,094 (GRCm39) missense probably damaging 1.00
R6074:Or4p23 UTSW 2 88,576,566 (GRCm39) missense probably damaging 1.00
R6105:Or4p23 UTSW 2 88,577,184 (GRCm39) missense probably benign 0.01
R6781:Or4p23 UTSW 2 88,577,174 (GRCm39) missense probably benign 0.01
R8745:Or4p23 UTSW 2 88,576,408 (GRCm39) missense possibly damaging 0.79
R9058:Or4p23 UTSW 2 88,577,030 (GRCm39) missense
R9355:Or4p23 UTSW 2 88,576,749 (GRCm39) missense probably damaging 0.97
R9660:Or4p23 UTSW 2 88,576,872 (GRCm39) missense probably damaging 1.00
Z1088:Or4p23 UTSW 2 88,576,922 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCTCAGGATGGACAAAATG -3'
(R):5'- AATCTCCTACAATGGCTGCATAG -3'

Sequencing Primer
(F):5'- TGACCAAGGCAAGAAAGGTC -3'
(R):5'- GCATAGCCCAGATGTTTTATGCAC -3'
Posted On 2022-03-25