Incidental Mutation 'R9264:Tm4sf1'
ID 702408
Institutional Source Beutler Lab
Gene Symbol Tm4sf1
Ensembl Gene ENSMUSG00000027800
Gene Name transmembrane 4 superfamily member 1
Synonyms M3s1, L6, 12A8 target antigen, L6 antigen
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 57193032-57209409 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 57202031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029376] [ENSMUST00000171384] [ENSMUST00000196506] [ENSMUST00000196979]
AlphaFold Q64302
Predicted Effect probably null
Transcript: ENSMUST00000029376
SMART Domains Protein: ENSMUSP00000029376
Gene: ENSMUSG00000027800

DomainStartEndE-ValueType
Pfam:L6_membrane 1 194 6e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171384
SMART Domains Protein: ENSMUSP00000130999
Gene: ENSMUSG00000027800

DomainStartEndE-ValueType
Pfam:L6_membrane 1 195 1.2e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196506
SMART Domains Protein: ENSMUSP00000143697
Gene: ENSMUSG00000027800

DomainStartEndE-ValueType
Pfam:L6_membrane 1 137 3.5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196979
SMART Domains Protein: ENSMUSP00000143652
Gene: ENSMUSG00000027800

DomainStartEndE-ValueType
Pfam:L6_membrane 1 194 6e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface antigen and is highly expressed in different carcinomas. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Tm4sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02004:Tm4sf1 APN 3 57,200,499 (GRCm39) missense possibly damaging 0.87
IGL03247:Tm4sf1 APN 3 57,200,436 (GRCm39) missense possibly damaging 0.70
IGL02988:Tm4sf1 UTSW 3 57,200,537 (GRCm39) splice site probably null
R0195:Tm4sf1 UTSW 3 57,200,480 (GRCm39) missense probably damaging 1.00
R1710:Tm4sf1 UTSW 3 57,200,304 (GRCm39) missense probably damaging 1.00
R4573:Tm4sf1 UTSW 3 57,202,206 (GRCm39) missense possibly damaging 0.78
R4801:Tm4sf1 UTSW 3 57,202,100 (GRCm39) missense probably damaging 1.00
R4802:Tm4sf1 UTSW 3 57,202,100 (GRCm39) missense probably damaging 1.00
R4917:Tm4sf1 UTSW 3 57,200,448 (GRCm39) missense probably damaging 1.00
R4918:Tm4sf1 UTSW 3 57,200,448 (GRCm39) missense probably damaging 1.00
R5127:Tm4sf1 UTSW 3 57,200,289 (GRCm39) missense possibly damaging 0.79
R5670:Tm4sf1 UTSW 3 57,200,508 (GRCm39) missense probably benign 0.03
R5946:Tm4sf1 UTSW 3 57,200,289 (GRCm39) missense possibly damaging 0.79
R6905:Tm4sf1 UTSW 3 57,202,330 (GRCm39) start gained probably benign
R7334:Tm4sf1 UTSW 3 57,200,510 (GRCm39) missense probably damaging 1.00
R7508:Tm4sf1 UTSW 3 57,202,176 (GRCm39) missense probably benign
R8013:Tm4sf1 UTSW 3 57,200,319 (GRCm39) missense probably benign 0.04
R8014:Tm4sf1 UTSW 3 57,200,319 (GRCm39) missense probably benign 0.04
R8024:Tm4sf1 UTSW 3 57,195,186 (GRCm39) nonsense probably null
R9430:Tm4sf1 UTSW 3 57,197,214 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTTCTGAGAAAAGAGACTTCTC -3'
(R):5'- TGTGCTACGTAAAGTGTGCAAG -3'

Sequencing Primer
(F):5'- TAAAGCAACATCTAATAAGGTCAGC -3'
(R):5'- GCAAGATACATCGGATACTCTCTGG -3'
Posted On 2022-03-25