Incidental Mutation 'R9264:Cyp4a10'
ID 702412
Institutional Source Beutler Lab
Gene Symbol Cyp4a10
Ensembl Gene ENSMUSG00000066072
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 10
Synonyms RP1, D4Rp1, Cyp4a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 115518264-115533649 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115524278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 180 (S180P)
Ref Sequence ENSEMBL: ENSMUSP00000061126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058785] [ENSMUST00000094886]
AlphaFold O88833
Predicted Effect probably benign
Transcript: ENSMUST00000058785
AA Change: S180P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000061126
Gene: ENSMUSG00000066072
AA Change: S180P

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 504 2.3e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094886
AA Change: S170P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000092486
Gene: ENSMUSG00000066072
AA Change: S170P

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:p450 51 494 4.5e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display salt-sensitive hypertension, decrease sodium excretion, and decreased urine output. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,116,466 M1L probably benign Het
Abca15 A T 7: 120,401,833 I1531L probably benign Het
Adam28 T C 14: 68,607,465 Y791C probably benign Het
Ankrd40 T A 11: 94,338,361 I262N probably damaging Het
BC067074 G A 13: 113,319,480 V687M Het
Catsperg2 A T 7: 29,698,188 N1033K possibly damaging Het
Cdh10 A T 15: 18,963,995 D81V probably damaging Het
Cep290 T C 10: 100,498,016 V310A possibly damaging Het
Cep78 T C 19: 15,974,466 Y325C probably damaging Het
Clstn3 T A 6: 124,459,768 D197V probably damaging Het
Col11a1 T C 3: 114,212,160 I1647T unknown Het
Col5a1 G A 2: 27,964,111 R569K unknown Het
D630045J12Rik T C 6: 38,158,238 I1336V probably benign Het
Dchs2 G A 3: 83,270,477 V946M probably damaging Het
Dnah10 A G 5: 124,736,836 R347G probably damaging Het
Dnah11 T A 12: 118,027,527 D2368V probably damaging Het
Ganab T C 19: 8,912,864 I719T possibly damaging Het
Gm10944 C A 10: 10,681,839 A11D unknown Het
Gmcl1 T C 6: 86,714,213 M267V probably benign Het
Inhbe T A 10: 127,350,558 D251V probably damaging Het
Kcnj1 G A 9: 32,396,358 R26Q probably benign Het
Lama5 A G 2: 180,196,478 probably benign Het
Lin9 T A 1: 180,667,347 D251E probably damaging Het
Magel2 T A 7: 62,378,596 I416N possibly damaging Het
Mdga2 T C 12: 66,513,283 N772S probably damaging Het
Msh3 G T 13: 92,349,304 Q171K probably benign Het
Mslnl T G 17: 25,742,532 probably benign Het
Mtpn A G 6: 35,512,241 L116P possibly damaging Het
Myh7 T C 14: 54,975,997 T1351A probably benign Het
Nectin3 A T 16: 46,454,635 I353N probably damaging Het
Nprl3 A T 11: 32,233,948 N500K probably benign Het
Nup93 T A 8: 94,292,720 I181N probably benign Het
Olfr1198 T C 2: 88,746,432 H152R probably damaging Het
Olfr362 G A 2: 37,104,789 T287I probably damaging Het
Optc T C 1: 133,905,240 I41V probably benign Het
Pcdh7 C A 5: 58,129,321 N1246K probably benign Het
Pcdhb3 T A 18: 37,302,113 D377E probably benign Het
Pnpla6 C T 8: 3,523,294 P386L probably benign Het
Polr3a T C 14: 24,470,831 T587A probably benign Het
Pramel1 T G 4: 143,398,529 L341R probably damaging Het
Rhot2 A T 17: 25,841,766 N210K probably damaging Het
Slc37a1 A G 17: 31,300,485 I12V probably benign Het
Spata48 T A 11: 11,464,678 D141E Het
Sstr3 G T 15: 78,539,592 N318K probably damaging Het
Ssx2ip T C 3: 146,437,200 V511A probably benign Het
Stfa1 G A 16: 36,280,568 V57I unknown Het
Syne1 T G 10: 5,262,793 R3265S probably damaging Het
Tacc2 G T 7: 130,626,803 K1739N probably damaging Het
Tas2r143 A T 6: 42,400,739 M168L probably benign Het
Tm4sf1 A T 3: 57,294,610 probably null Het
Ttc16 A G 2: 32,763,005 I604T possibly damaging Het
Ugt1a10 T A 1: 88,055,671 W64R possibly damaging Het
Usp34 A T 11: 23,489,064 H3561L Het
Vasp C T 7: 19,259,451 V276I unknown Het
Vwa3a A G 7: 120,775,464 N333S probably benign Het
Wipf3 A G 6: 54,483,881 N105D probably benign Het
Zfp760 T C 17: 21,723,682 S613P possibly damaging Het
Other mutations in Cyp4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00774:Cyp4a10 APN 4 115532538 missense probably damaging 1.00
IGL01301:Cyp4a10 APN 4 115518455 missense probably damaging 1.00
IGL02081:Cyp4a10 APN 4 115521172 missense possibly damaging 0.87
IGL02373:Cyp4a10 APN 4 115521077 nonsense probably null
IGL03411:Cyp4a10 APN 4 115525693 splice site probably null
ANU18:Cyp4a10 UTSW 4 115518455 missense probably damaging 1.00
PIT4142001:Cyp4a10 UTSW 4 115524875 missense probably damaging 0.99
PIT4151001:Cyp4a10 UTSW 4 115524875 missense probably damaging 0.99
R0016:Cyp4a10 UTSW 4 115521107 missense probably damaging 1.00
R0368:Cyp4a10 UTSW 4 115525377 nonsense probably null
R1319:Cyp4a10 UTSW 4 115521145 missense probably damaging 0.98
R1440:Cyp4a10 UTSW 4 115529449 missense probably damaging 1.00
R1531:Cyp4a10 UTSW 4 115518435 nonsense probably null
R2008:Cyp4a10 UTSW 4 115525392 missense probably damaging 0.98
R2064:Cyp4a10 UTSW 4 115524720 splice site probably benign
R2083:Cyp4a10 UTSW 4 115525308 missense possibly damaging 0.86
R2961:Cyp4a10 UTSW 4 115520270 missense probably benign 0.02
R3028:Cyp4a10 UTSW 4 115518431 missense possibly damaging 0.64
R3839:Cyp4a10 UTSW 4 115525347 missense possibly damaging 0.85
R3930:Cyp4a10 UTSW 4 115524783 missense probably benign 0.00
R4062:Cyp4a10 UTSW 4 115519701 missense probably benign 0.06
R4097:Cyp4a10 UTSW 4 115529283 missense probably damaging 0.99
R4298:Cyp4a10 UTSW 4 115532692 missense probably damaging 1.00
R4482:Cyp4a10 UTSW 4 115532598 missense probably damaging 1.00
R4592:Cyp4a10 UTSW 4 115529493 missense probably damaging 0.99
R4715:Cyp4a10 UTSW 4 115525338 missense probably benign 0.44
R4826:Cyp4a10 UTSW 4 115518344 missense probably benign 0.00
R4834:Cyp4a10 UTSW 4 115525808 missense probably damaging 1.00
R4922:Cyp4a10 UTSW 4 115521094 missense probably benign 0.01
R5202:Cyp4a10 UTSW 4 115532615 missense probably damaging 1.00
R5502:Cyp4a10 UTSW 4 115525505 missense probably benign 0.21
R6269:Cyp4a10 UTSW 4 115524312 missense probably damaging 1.00
R6349:Cyp4a10 UTSW 4 115525358 missense probably benign 0.00
R7684:Cyp4a10 UTSW 4 115518352 missense probably benign 0.18
R7863:Cyp4a10 UTSW 4 115518425 missense probably benign 0.00
R8392:Cyp4a10 UTSW 4 115529478 nonsense probably null
R8445:Cyp4a10 UTSW 4 115525594 missense probably damaging 1.00
R8744:Cyp4a10 UTSW 4 115529470 missense probably benign 0.00
R9297:Cyp4a10 UTSW 4 115521178 missense probably damaging 1.00
R9299:Cyp4a10 UTSW 4 115519750 missense probably benign 0.00
R9393:Cyp4a10 UTSW 4 115525369 missense probably damaging 1.00
Z1176:Cyp4a10 UTSW 4 115518326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTTGCTTATCAGATAAGACATC -3'
(R):5'- GATGTCCCACTTGCATCACAG -3'

Sequencing Primer
(F):5'- GTGAAACTTGCTTCCTTTCTTATGAG -3'
(R):5'- GATGTCCCACTTGCATCACAGAATAG -3'
Posted On 2022-03-25