Incidental Mutation 'R9264:Pramel1'
ID 702413
Institutional Source Beutler Lab
Gene Symbol Pramel1
Ensembl Gene ENSMUSG00000041805
Gene Name preferentially expressed antigen in melanoma-like 1
Synonyms
Accession Numbers

Ncbi RefSeq: NM_031377.2; MGI:1890541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 143394428-143400160 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 143398529 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 341 (L341R)
Ref Sequence ENSEMBL: ENSMUSP00000043718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037419]
AlphaFold Q99MW3
Predicted Effect probably damaging
Transcript: ENSMUST00000037419
AA Change: L341R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043718
Gene: ENSMUSG00000041805
AA Change: L341R

DomainStartEndE-ValueType
SCOP:d1a4ya_ 203 396 1e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,116,466 M1L probably benign Het
Abca15 A T 7: 120,401,833 I1531L probably benign Het
Adam28 T C 14: 68,607,465 Y791C probably benign Het
Ankrd40 T A 11: 94,338,361 I262N probably damaging Het
BC067074 G A 13: 113,319,480 V687M Het
Catsperg2 A T 7: 29,698,188 N1033K possibly damaging Het
Cdh10 A T 15: 18,963,995 D81V probably damaging Het
Cep290 T C 10: 100,498,016 V310A possibly damaging Het
Cep78 T C 19: 15,974,466 Y325C probably damaging Het
Clstn3 T A 6: 124,459,768 D197V probably damaging Het
Col11a1 T C 3: 114,212,160 I1647T unknown Het
Col5a1 G A 2: 27,964,111 R569K unknown Het
Cyp4a10 T C 4: 115,524,278 S180P probably benign Het
D630045J12Rik T C 6: 38,158,238 I1336V probably benign Het
Dchs2 G A 3: 83,270,477 V946M probably damaging Het
Dnah10 A G 5: 124,736,836 R347G probably damaging Het
Dnah11 T A 12: 118,027,527 D2368V probably damaging Het
Ganab T C 19: 8,912,864 I719T possibly damaging Het
Gm10944 C A 10: 10,681,839 A11D unknown Het
Gmcl1 T C 6: 86,714,213 M267V probably benign Het
Inhbe T A 10: 127,350,558 D251V probably damaging Het
Kcnj1 G A 9: 32,396,358 R26Q probably benign Het
Lama5 A G 2: 180,196,478 probably benign Het
Lin9 T A 1: 180,667,347 D251E probably damaging Het
Magel2 T A 7: 62,378,596 I416N possibly damaging Het
Mdga2 T C 12: 66,513,283 N772S probably damaging Het
Msh3 G T 13: 92,349,304 Q171K probably benign Het
Mslnl T G 17: 25,742,532 probably benign Het
Mtpn A G 6: 35,512,241 L116P possibly damaging Het
Myh7 T C 14: 54,975,997 T1351A probably benign Het
Nectin3 A T 16: 46,454,635 I353N probably damaging Het
Nprl3 A T 11: 32,233,948 N500K probably benign Het
Nup93 T A 8: 94,292,720 I181N probably benign Het
Olfr1198 T C 2: 88,746,432 H152R probably damaging Het
Olfr362 G A 2: 37,104,789 T287I probably damaging Het
Optc T C 1: 133,905,240 I41V probably benign Het
Pcdh7 C A 5: 58,129,321 N1246K probably benign Het
Pcdhb3 T A 18: 37,302,113 D377E probably benign Het
Pnpla6 C T 8: 3,523,294 P386L probably benign Het
Polr3a T C 14: 24,470,831 T587A probably benign Het
Rhot2 A T 17: 25,841,766 N210K probably damaging Het
Slc37a1 A G 17: 31,300,485 I12V probably benign Het
Spata48 T A 11: 11,464,678 D141E Het
Sstr3 G T 15: 78,539,592 N318K probably damaging Het
Ssx2ip T C 3: 146,437,200 V511A probably benign Het
Stfa1 G A 16: 36,280,568 V57I unknown Het
Syne1 T G 10: 5,262,793 R3265S probably damaging Het
Tacc2 G T 7: 130,626,803 K1739N probably damaging Het
Tas2r143 A T 6: 42,400,739 M168L probably benign Het
Tm4sf1 A T 3: 57,294,610 probably null Het
Ttc16 A G 2: 32,763,005 I604T possibly damaging Het
Ugt1a10 T A 1: 88,055,671 W64R possibly damaging Het
Usp34 A T 11: 23,489,064 H3561L Het
Vasp C T 7: 19,259,451 V276I unknown Het
Vwa3a A G 7: 120,775,464 N333S probably benign Het
Wipf3 A G 6: 54,483,881 N105D probably benign Het
Zfp760 T C 17: 21,723,682 S613P possibly damaging Het
Other mutations in Pramel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Pramel1 APN 4 143397556 missense probably damaging 1.00
IGL01363:Pramel1 APN 4 143397385 missense probably benign 0.00
IGL01713:Pramel1 APN 4 143397082 missense probably benign 0.01
IGL02334:Pramel1 APN 4 143397526 missense probably damaging 0.98
IGL02957:Pramel1 APN 4 143397598 missense probably benign 0.22
P0045:Pramel1 UTSW 4 143398522 nonsense probably null
PIT4431001:Pramel1 UTSW 4 143398390 missense possibly damaging 0.61
R0136:Pramel1 UTSW 4 143397446 missense probably damaging 1.00
R0544:Pramel1 UTSW 4 143397605 missense possibly damaging 0.94
R0612:Pramel1 UTSW 4 143397531 missense probably damaging 0.99
R1700:Pramel1 UTSW 4 143398429 missense probably damaging 1.00
R2425:Pramel1 UTSW 4 143398466 missense probably damaging 1.00
R2927:Pramel1 UTSW 4 143398818 missense probably benign
R4012:Pramel1 UTSW 4 143396690 missense possibly damaging 0.48
R5253:Pramel1 UTSW 4 143398586 missense probably benign 0.03
R5388:Pramel1 UTSW 4 143397384 missense probably benign 0.00
R6457:Pramel1 UTSW 4 143396705 missense probably damaging 1.00
R7052:Pramel1 UTSW 4 143396504 missense probably damaging 1.00
R7543:Pramel1 UTSW 4 143398423 missense probably damaging 0.99
R7964:Pramel1 UTSW 4 143397240 missense probably benign 0.03
R8532:Pramel1 UTSW 4 143398555 missense probably benign 0.04
R8977:Pramel1 UTSW 4 143397391 missense probably benign 0.08
R9284:Pramel1 UTSW 4 143397199 missense probably benign 0.43
R9466:Pramel1 UTSW 4 143397229 missense probably benign 0.10
R9769:Pramel1 UTSW 4 143398540 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGAACCAGATGCATATTCCCAG -3'
(R):5'- CTGCTTGACAACGTTATATGCC -3'

Sequencing Primer
(F):5'- CAGATGCATATTCCCAGAAATGTC -3'
(R):5'- TATATGCCAGCTCCCTCAGGATAGG -3'
Posted On 2022-03-25