Incidental Mutation 'R9264:Mtpn'
ID 702416
Institutional Source Beutler Lab
Gene Symbol Mtpn
Ensembl Gene ENSMUSG00000029840
Gene Name myotrophin
Synonyms V1, Gcdp, 5033418D15Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.405) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 35485841-35516823 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35489176 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 116 (L116P)
Ref Sequence ENSEMBL: ENSMUSP00000031866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031866]
AlphaFold P62774
PDB Structure Solution NMR structure of V-1 bound to capping protein (CP) [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031866
AA Change: L116P

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031866
Gene: ENSMUSG00000029840
AA Change: L116P

DomainStartEndE-ValueType
Blast:ANK 1 30 8e-9 BLAST
ANK 34 63 7.64e-6 SMART
ANK 67 96 1.14e-4 SMART
Meta Mutation Damage Score 0.8055 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transcript produced from this gene is bi-cistronic and can encode both myotrophin and leucine zipper protein 6. The myotrophin protein is associated with cardiac hypertrophy, where it is involved in the conversion of NFkappa B p50-p65 heterodimers to p50-p50 and p65-p65 homodimers. This protein also has a potential function in cerebellar morphogenesis, and it may be involved in the differentiation of cerebellar neurons, particularly of granule cells. A cryptic ORF at the 3' end of this transcript uses a novel internal ribosome entry site and a non-AUG translation initiation codon to produce leucine zipper protein 6, a 6.4 kDa tumor antigen that is associated with myeloproliferative disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Mtpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mtpn APN 6 35,499,711 (GRCm39) missense probably damaging 0.96
IGL00957:Mtpn APN 6 35,516,547 (GRCm39) utr 5 prime probably benign
IGL03238:Mtpn APN 6 35,499,708 (GRCm39) missense probably damaging 1.00
lamco UTSW 6 35,499,693 (GRCm39) missense possibly damaging 0.65
R0972:Mtpn UTSW 6 35,498,911 (GRCm39) missense probably null 0.78
R1311:Mtpn UTSW 6 35,489,185 (GRCm39) missense possibly damaging 0.94
R1462:Mtpn UTSW 6 35,499,693 (GRCm39) missense possibly damaging 0.65
R1462:Mtpn UTSW 6 35,499,693 (GRCm39) missense possibly damaging 0.65
R3076:Mtpn UTSW 6 35,498,879 (GRCm39) missense possibly damaging 0.67
R5297:Mtpn UTSW 6 35,489,225 (GRCm39) missense probably benign 0.00
R5334:Mtpn UTSW 6 35,489,225 (GRCm39) missense probably benign 0.00
R5336:Mtpn UTSW 6 35,489,225 (GRCm39) missense probably benign 0.00
R5337:Mtpn UTSW 6 35,489,225 (GRCm39) missense probably benign 0.00
R5512:Mtpn UTSW 6 35,489,225 (GRCm39) missense probably benign 0.00
R5809:Mtpn UTSW 6 35,489,225 (GRCm39) missense probably benign 0.00
R5841:Mtpn UTSW 6 35,489,225 (GRCm39) missense probably benign 0.00
R5842:Mtpn UTSW 6 35,489,225 (GRCm39) missense probably benign 0.00
R5843:Mtpn UTSW 6 35,489,225 (GRCm39) missense probably benign 0.00
R5844:Mtpn UTSW 6 35,489,225 (GRCm39) missense probably benign 0.00
R5846:Mtpn UTSW 6 35,489,225 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCCTGGCAGTCTGATTTGTT -3'
(R):5'- GGTTAAGTGAGCTCCAACTCTC -3'

Sequencing Primer
(F):5'- GCAGTCTGATTTGTTATGAATTTCTC -3'
(R):5'- CAACTGTCCAGAGTTGGTTCAG -3'
Posted On 2022-03-25