Incidental Mutation 'R9264:D630045J12Rik'
ID 702417
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene Name RIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 38100109-38230944 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38135173 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1336 (I1336V)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
AlphaFold Q68FD9
Predicted Effect probably benign
Transcript: ENSMUST00000117556
AA Change: I1195V

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: I1195V

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169256
AA Change: I1336V

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: I1336V

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38,171,865 (GRCm39) missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38,113,898 (GRCm39) missense probably benign
IGL01745:D630045J12Rik APN 6 38,168,655 (GRCm39) missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38,161,007 (GRCm39) missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38,173,329 (GRCm39) missense probably benign
IGL02496:D630045J12Rik APN 6 38,126,640 (GRCm39) missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38,172,420 (GRCm39) missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38,126,648 (GRCm39) missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38,145,156 (GRCm39) missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38,124,194 (GRCm39) missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38,155,774 (GRCm39) missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38,172,036 (GRCm39) missense probably benign
R0021:D630045J12Rik UTSW 6 38,160,902 (GRCm39) nonsense probably null
R0021:D630045J12Rik UTSW 6 38,160,902 (GRCm39) nonsense probably null
R0128:D630045J12Rik UTSW 6 38,126,706 (GRCm39) splice site probably benign
R0130:D630045J12Rik UTSW 6 38,126,706 (GRCm39) splice site probably benign
R0206:D630045J12Rik UTSW 6 38,116,385 (GRCm39) missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38,116,385 (GRCm39) missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38,158,327 (GRCm39) missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38,173,671 (GRCm39) missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38,168,628 (GRCm39) missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38,173,713 (GRCm39) missense probably benign
R0842:D630045J12Rik UTSW 6 38,125,400 (GRCm39) missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38,171,705 (GRCm39) missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38,125,443 (GRCm39) missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38,125,443 (GRCm39) missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38,172,695 (GRCm39) missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38,167,590 (GRCm39) missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38,158,366 (GRCm39) missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38,116,362 (GRCm39) missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38,145,078 (GRCm39) missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38,145,078 (GRCm39) missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38,151,082 (GRCm39) critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38,135,026 (GRCm39) missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38,145,106 (GRCm39) missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38,119,844 (GRCm39) missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38,119,633 (GRCm39) missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38,171,696 (GRCm39) missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38,173,592 (GRCm39) missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38,172,971 (GRCm39) missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38,173,776 (GRCm39) missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38,125,275 (GRCm39) missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38,171,420 (GRCm39) missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38,125,478 (GRCm39) missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38,125,302 (GRCm39) missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38,125,302 (GRCm39) missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38,171,555 (GRCm39) missense probably benign
R5344:D630045J12Rik UTSW 6 38,135,163 (GRCm39) missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38,173,782 (GRCm39) missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38,173,782 (GRCm39) missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38,168,699 (GRCm39) missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38,173,302 (GRCm39) missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38,119,592 (GRCm39) missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38,171,904 (GRCm39) missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38,167,552 (GRCm39) missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38,107,799 (GRCm39) missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38,119,633 (GRCm39) missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38,124,132 (GRCm39) nonsense probably null
R6930:D630045J12Rik UTSW 6 38,135,151 (GRCm39) missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38,171,570 (GRCm39) missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38,171,964 (GRCm39) missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38,145,198 (GRCm39) missense probably damaging 1.00
R7249:D630045J12Rik UTSW 6 38,113,885 (GRCm39) missense possibly damaging 0.95
R7250:D630045J12Rik UTSW 6 38,119,546 (GRCm39) missense possibly damaging 0.80
R7376:D630045J12Rik UTSW 6 38,151,238 (GRCm39) missense probably damaging 0.99
R7491:D630045J12Rik UTSW 6 38,119,601 (GRCm39) missense possibly damaging 0.89
R7552:D630045J12Rik UTSW 6 38,125,383 (GRCm39) missense probably damaging 0.99
R7560:D630045J12Rik UTSW 6 38,173,562 (GRCm39) missense possibly damaging 0.72
R7593:D630045J12Rik UTSW 6 38,172,429 (GRCm39) missense possibly damaging 0.93
R7624:D630045J12Rik UTSW 6 38,126,498 (GRCm39) missense probably damaging 1.00
R7654:D630045J12Rik UTSW 6 38,154,636 (GRCm39) missense probably damaging 1.00
R8159:D630045J12Rik UTSW 6 38,105,410 (GRCm39) missense probably damaging 0.99
R8167:D630045J12Rik UTSW 6 38,167,484 (GRCm39) critical splice donor site probably null
R8189:D630045J12Rik UTSW 6 38,135,106 (GRCm39) missense probably damaging 1.00
R8260:D630045J12Rik UTSW 6 38,119,846 (GRCm39) critical splice acceptor site probably null
R8270:D630045J12Rik UTSW 6 38,167,658 (GRCm39) nonsense probably null
R8331:D630045J12Rik UTSW 6 38,125,409 (GRCm39) missense probably damaging 1.00
R8363:D630045J12Rik UTSW 6 38,125,376 (GRCm39) missense probably damaging 1.00
R8365:D630045J12Rik UTSW 6 38,172,570 (GRCm39) missense probably benign
R8492:D630045J12Rik UTSW 6 38,167,525 (GRCm39) missense probably damaging 1.00
R8560:D630045J12Rik UTSW 6 38,126,649 (GRCm39) missense probably damaging 1.00
R8987:D630045J12Rik UTSW 6 38,173,898 (GRCm39) missense probably benign 0.11
R9052:D630045J12Rik UTSW 6 38,154,544 (GRCm39) missense probably damaging 1.00
R9273:D630045J12Rik UTSW 6 38,167,512 (GRCm39) missense possibly damaging 0.88
R9431:D630045J12Rik UTSW 6 38,173,814 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CTGAGCCGTATGTTCTTGGAAG -3'
(R):5'- TTGGACCTCACGCTATCCAC -3'

Sequencing Primer
(F):5'- CCGTATGTTCTTGGAAGGGAGC -3'
(R):5'- AACCACCCATTGTGTTTCACG -3'
Posted On 2022-03-25