Incidental Mutation 'R9264:Tas2r143'
ID 702418
Institutional Source Beutler Lab
Gene Symbol Tas2r143
Ensembl Gene ENSMUSG00000046652
Gene Name taste receptor, type 2, member 143
Synonyms Tas2r43, mt2r36
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42377172-42378053 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42377673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 168 (M168L)
Ref Sequence ENSEMBL: ENSMUSP00000057910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057398] [ENSMUST00000070178]
AlphaFold Q7TQB9
Predicted Effect probably benign
Transcript: ENSMUST00000057398
AA Change: M168L

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000057910
Gene: ENSMUSG00000046652
AA Change: M168L

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 6.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070178
SMART Domains Protein: ENSMUSP00000070247
Gene: ENSMUSG00000056203

DomainStartEndE-ValueType
Pfam:TAS2R 22 320 1.3e-63 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Tas2r143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Tas2r143 APN 6 42,377,268 (GRCm39) nonsense probably null
IGL02832:Tas2r143 APN 6 42,377,259 (GRCm39) missense possibly damaging 0.55
R0125:Tas2r143 UTSW 6 42,377,889 (GRCm39) missense probably benign 0.01
R1035:Tas2r143 UTSW 6 42,377,199 (GRCm39) missense probably benign 0.16
R1073:Tas2r143 UTSW 6 42,377,694 (GRCm39) missense probably benign 0.01
R1400:Tas2r143 UTSW 6 42,377,317 (GRCm39) missense probably benign 0.35
R1774:Tas2r143 UTSW 6 42,377,305 (GRCm39) missense probably damaging 1.00
R2391:Tas2r143 UTSW 6 42,377,810 (GRCm39) missense probably damaging 0.99
R3617:Tas2r143 UTSW 6 42,377,997 (GRCm39) missense probably benign 0.20
R3693:Tas2r143 UTSW 6 42,377,910 (GRCm39) missense probably benign 0.00
R4283:Tas2r143 UTSW 6 42,378,007 (GRCm39) splice site probably null
R4486:Tas2r143 UTSW 6 42,377,628 (GRCm39) missense probably benign 0.15
R5005:Tas2r143 UTSW 6 42,377,658 (GRCm39) missense probably benign 0.02
R6360:Tas2r143 UTSW 6 42,377,769 (GRCm39) missense probably benign 0.40
R7163:Tas2r143 UTSW 6 42,377,202 (GRCm39) missense probably benign
R7827:Tas2r143 UTSW 6 42,377,656 (GRCm39) missense probably damaging 1.00
R8899:Tas2r143 UTSW 6 42,377,888 (GRCm39) nonsense probably null
R8989:Tas2r143 UTSW 6 42,377,828 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCATCTTCTACTGTGTGAAG -3'
(R):5'- GGGATTTCAGAGCCATGGTATG -3'

Sequencing Primer
(F):5'- GCCATCTTCTACTGTGTGAAGATCTC -3'
(R):5'- ATGTGCCTGAGTATGGAGATCCC -3'
Posted On 2022-03-25