Mutagenetix > Incidental Mutation

Incidental Mutation 'R9264:Clstn3'

702421

Institutional Source

Beutler Lab

Gene Symbol

Clstn3

Ensembl Gene

ENSMUSG00000008153

Gene Name

calsyntenin 3

Synonyms

alcadein-beta, Cst-3, CSTN3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124430759-124464794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 124459768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 197 (D197V)

Ref Sequence

ENSEMBL: ENSMUSP00000008297 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523] [ENSMUST00000150774]

AlphaFold

Q99JH7

Predicted Effect

probably damaging
Transcript: ENSMUST00000008297
AA Change: D197V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: D197V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
CA	50	143	2.72e-12	SMART
CA	166	244	4.04e-2	SMART
SCOP:d1a8d_1	333	549	7e-23	SMART
transmembrane domain	846	868	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112523
AA Change: D160V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: D160V

Domain	Start	End	E-Value	Type
CA	13	106	2.72e-12	SMART
CA	129	207	4.04e-2	SMART
Pfam:Laminin_G_3	304	505	4.1e-8	PFAM
transmembrane domain	809	831	N/A	INTRINSIC
low complexity region	891	908	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150774

SMART Domains

Protein: ENSMUSP00000145422
Gene: ENSMUSG00000008153

Domain	Start	End	E-Value	Type
Blast:CA	13	64	4e-31	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,116,466	M1L	probably benign	Het
Abca15	A	T	7: 120,401,833	I1531L	probably benign	Het
Adam28	T	C	14: 68,607,465	Y791C	probably benign	Het
Ankrd40	T	A	11: 94,338,361	I262N	probably damaging	Het
BC067074	G	A	13: 113,319,480	V687M		Het
Catsperg2	A	T	7: 29,698,188	N1033K	possibly damaging	Het
Cdh10	A	T	15: 18,963,995	D81V	probably damaging	Het
Cep290	T	C	10: 100,498,016	V310A	possibly damaging	Het
Cep78	T	C	19: 15,974,466	Y325C	probably damaging	Het
Col11a1	T	C	3: 114,212,160	I1647T	unknown	Het
Col5a1	G	A	2: 27,964,111	R569K	unknown	Het
Cyp4a10	T	C	4: 115,524,278	S180P	probably benign	Het
D630045J12Rik	T	C	6: 38,158,238	I1336V	probably benign	Het
Dchs2	G	A	3: 83,270,477	V946M	probably damaging	Het
Dnah10	A	G	5: 124,736,836	R347G	probably damaging	Het
Dnah11	T	A	12: 118,027,527	D2368V	probably damaging	Het
Ganab	T	C	19: 8,912,864	I719T	possibly damaging	Het
Gm10944	C	A	10: 10,681,839	A11D	unknown	Het
Gmcl1	T	C	6: 86,714,213	M267V	probably benign	Het
Inhbe	T	A	10: 127,350,558	D251V	probably damaging	Het
Kcnj1	G	A	9: 32,396,358	R26Q	probably benign	Het
Lama5	A	G	2: 180,196,478		probably benign	Het
Lin9	T	A	1: 180,667,347	D251E	probably damaging	Het
Magel2	T	A	7: 62,378,596	I416N	possibly damaging	Het
Mdga2	T	C	12: 66,513,283	N772S	probably damaging	Het
Msh3	G	T	13: 92,349,304	Q171K	probably benign	Het
Mslnl	T	G	17: 25,742,532		probably benign	Het
Mtpn	A	G	6: 35,512,241	L116P	possibly damaging	Het
Myh7	T	C	14: 54,975,997	T1351A	probably benign	Het
Nectin3	A	T	16: 46,454,635	I353N	probably damaging	Het
Nprl3	A	T	11: 32,233,948	N500K	probably benign	Het
Nup93	T	A	8: 94,292,720	I181N	probably benign	Het
Olfr1198	T	C	2: 88,746,432	H152R	probably damaging	Het
Olfr362	G	A	2: 37,104,789	T287I	probably damaging	Het
Optc	T	C	1: 133,905,240	I41V	probably benign	Het
Pcdh7	C	A	5: 58,129,321	N1246K	probably benign	Het
Pcdhb3	T	A	18: 37,302,113	D377E	probably benign	Het
Pnpla6	C	T	8: 3,523,294	P386L	probably benign	Het
Polr3a	T	C	14: 24,470,831	T587A	probably benign	Het
Pramel1	T	G	4: 143,398,529	L341R	probably damaging	Het
Rhot2	A	T	17: 25,841,766	N210K	probably damaging	Het
Slc37a1	A	G	17: 31,300,485	I12V	probably benign	Het
Spata48	T	A	11: 11,464,678	D141E		Het
Sstr3	G	T	15: 78,539,592	N318K	probably damaging	Het
Ssx2ip	T	C	3: 146,437,200	V511A	probably benign	Het
Stfa1	G	A	16: 36,280,568	V57I	unknown	Het
Syne1	T	G	10: 5,262,793	R3265S	probably damaging	Het
Tacc2	G	T	7: 130,626,803	K1739N	probably damaging	Het
Tas2r143	A	T	6: 42,400,739	M168L	probably benign	Het
Tm4sf1	A	T	3: 57,294,610		probably null	Het
Ttc16	A	G	2: 32,763,005	I604T	possibly damaging	Het
Ugt1a10	T	A	1: 88,055,671	W64R	possibly damaging	Het
Usp34	A	T	11: 23,489,064	H3561L		Het
Vasp	C	T	7: 19,259,451	V276I	unknown	Het
Vwa3a	A	G	7: 120,775,464	N333S	probably benign	Het
Wipf3	A	G	6: 54,483,881	N105D	probably benign	Het
Zfp760	T	C	17: 21,723,682	S613P	possibly damaging	Het

Other mutations in Clstn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Clstn3	APN	6	124462139	missense	probably damaging	1.00
IGL01415:Clstn3	APN	6	124438822	nonsense	probably null
IGL01521:Clstn3	APN	6	124458031	nonsense	probably null
IGL01537:Clstn3	APN	6	124431600	missense	possibly damaging	0.91
IGL01729:Clstn3	APN	6	124449794	missense	probably benign	0.06
IGL01879:Clstn3	APN	6	124438810	missense	probably damaging	1.00
IGL01998:Clstn3	APN	6	124458663	missense	probably damaging	1.00
IGL03130:Clstn3	APN	6	124459263	missense	probably damaging	0.98
IGL03405:Clstn3	APN	6	124438368	missense	possibly damaging	0.95
PIT4403001:Clstn3	UTSW	6	124458023	missense	probably damaging	1.00
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0208:Clstn3	UTSW	6	124432169	splice site	probably benign
R0276:Clstn3	UTSW	6	124431740	splice site	probably benign
R0440:Clstn3	UTSW	6	124451413	missense	probably damaging	1.00
R0612:Clstn3	UTSW	6	124449500	missense	probably damaging	0.98
R1200:Clstn3	UTSW	6	124459170	missense	probably damaging	1.00
R1224:Clstn3	UTSW	6	124457919	missense	probably benign
R1378:Clstn3	UTSW	6	124438419	missense	probably damaging	1.00
R1491:Clstn3	UTSW	6	124437490	missense	possibly damaging	0.51
R1495:Clstn3	UTSW	6	124449917	missense	probably benign	0.00
R1511:Clstn3	UTSW	6	124462169	missense	probably damaging	1.00
R1655:Clstn3	UTSW	6	124437427	missense	probably damaging	1.00
R1731:Clstn3	UTSW	6	124431632	missense	probably benign	0.04
R1734:Clstn3	UTSW	6	124436814	splice site	probably benign
R1751:Clstn3	UTSW	6	124431999	missense	probably damaging	1.00
R1954:Clstn3	UTSW	6	124459298	missense	possibly damaging	0.94
R2133:Clstn3	UTSW	6	124449503	missense	probably benign
R2192:Clstn3	UTSW	6	124459207	missense	probably damaging	1.00
R2314:Clstn3	UTSW	6	124450717	missense	probably benign	0.39
R2874:Clstn3	UTSW	6	124438335	missense	probably damaging	1.00
R3500:Clstn3	UTSW	6	124431711	missense	probably benign	0.01
R3761:Clstn3	UTSW	6	124457876	missense	possibly damaging	0.54
R3878:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R3927:Clstn3	UTSW	6	124451368	missense	probably damaging	1.00
R3934:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R3935:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R4063:Clstn3	UTSW	6	124449833	missense	possibly damaging	0.51
R4402:Clstn3	UTSW	6	124456980	missense	probably damaging	0.96
R4534:Clstn3	UTSW	6	124459220	missense	probably damaging	1.00
R4785:Clstn3	UTSW	6	124437372	splice site	probably null
R4834:Clstn3	UTSW	6	124431953	splice site	probably null
R5921:Clstn3	UTSW	6	124431580	utr 3 prime	probably benign
R5932:Clstn3	UTSW	6	124438332	missense	probably benign	0.01
R6025:Clstn3	UTSW	6	124431664	missense	possibly damaging	0.73
R6101:Clstn3	UTSW	6	124461670	missense	probably damaging	1.00
R6360:Clstn3	UTSW	6	124438429	missense	possibly damaging	0.88
R6578:Clstn3	UTSW	6	124450704	critical splice donor site	probably null
R6813:Clstn3	UTSW	6	124436935	missense	probably benign	0.00
R7380:Clstn3	UTSW	6	124456989	missense	probably benign	0.01
R7419:Clstn3	UTSW	6	124458129	missense	probably benign	0.05
R7625:Clstn3	UTSW	6	124437418	nonsense	probably null
R7780:Clstn3	UTSW	6	124462202	missense	probably damaging	0.98
R7936:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R7939:Clstn3	UTSW	6	124462199	missense	probably damaging	1.00
R8047:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R8079:Clstn3	UTSW	6	124459804	missense	probably damaging	1.00
R8085:Clstn3	UTSW	6	124458724	missense	probably benign	0.23
R8299:Clstn3	UTSW	6	124437373	critical splice donor site	probably null
R8406:Clstn3	UTSW	6	124462177	missense	probably damaging	1.00
R8685:Clstn3	UTSW	6	124456908	missense	probably damaging	1.00
R9045:Clstn3	UTSW	6	124431962	missense	probably damaging	0.98
R9209:Clstn3	UTSW	6	124431612	missense	probably benign	0.02
R9268:Clstn3	UTSW	6	124456921	missense	probably damaging	0.99
R9443:Clstn3	UTSW	6	124451399	missense	probably damaging	1.00
RF014:Clstn3	UTSW	6	124459266	nonsense	probably null
X0066:Clstn3	UTSW	6	124449811	missense	probably benign	0.13
Z1176:Clstn3	UTSW	6	124459200	missense	probably damaging	1.00
Z1177:Clstn3	UTSW	6	124449781	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCAGGAAGGCATGAGTATACTTG -3'
(R):5'- CGTGCATGTTCGGGTCAATG -3'

Sequencing Primer
(F):5'- GGCATGAGTATACTTGGCACATAC -3'
(R):5'- CAATGATGTGAATGAGTTTGCCCC -3'

Posted On

2022-03-25