Incidental Mutation 'R9264:Catsperg2'
ID 702423
Institutional Source Beutler Lab
Gene Symbol Catsperg2
Ensembl Gene ENSMUSG00000049123
Gene Name cation channel sperm associated auxiliary subunit gamma 2
Synonyms CATSPERG, 1700067C01Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 29396644-29426457 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29397613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1033 (N1033K)
Ref Sequence ENSEMBL: ENSMUSP00000147099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061193] [ENSMUST00000207115] [ENSMUST00000208371] [ENSMUST00000208607] [ENSMUST00000209126]
AlphaFold C6KI89
Predicted Effect possibly damaging
Transcript: ENSMUST00000061193
AA Change: N1033K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052285
Gene: ENSMUSG00000049123
AA Change: N1033K

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207115
Predicted Effect probably benign
Transcript: ENSMUST00000208371
Predicted Effect probably benign
Transcript: ENSMUST00000208607
Predicted Effect possibly damaging
Transcript: ENSMUST00000209126
AA Change: N1033K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.4777 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Catsperg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Catsperg2 APN 7 29,404,829 (GRCm39) missense possibly damaging 0.86
IGL00095:Catsperg2 APN 7 29,397,483 (GRCm39) missense possibly damaging 0.73
IGL00902:Catsperg2 APN 7 29,400,568 (GRCm39) missense possibly damaging 0.93
IGL01667:Catsperg2 APN 7 29,409,558 (GRCm39) missense probably damaging 0.98
IGL01791:Catsperg2 APN 7 29,404,090 (GRCm39) splice site probably null
IGL01961:Catsperg2 APN 7 29,421,097 (GRCm39) splice site probably benign
IGL02187:Catsperg2 APN 7 29,420,791 (GRCm39) missense probably benign 0.02
IGL02605:Catsperg2 APN 7 29,418,990 (GRCm39) missense possibly damaging 0.71
IGL03001:Catsperg2 APN 7 29,424,504 (GRCm39) missense probably benign 0.32
IGL03228:Catsperg2 APN 7 29,397,650 (GRCm39) missense probably damaging 0.96
IGL03239:Catsperg2 APN 7 29,397,141 (GRCm39) missense probably benign 0.04
IGL03242:Catsperg2 APN 7 29,424,904 (GRCm39) unclassified probably benign
IGL03247:Catsperg2 APN 7 29,416,473 (GRCm39) missense possibly damaging 0.71
IGL03256:Catsperg2 APN 7 29,409,299 (GRCm39) missense probably damaging 0.99
PIT4520001:Catsperg2 UTSW 7 29,409,586 (GRCm39) missense possibly damaging 0.93
R0052:Catsperg2 UTSW 7 29,424,445 (GRCm39) splice site probably benign
R0281:Catsperg2 UTSW 7 29,405,996 (GRCm39) missense possibly damaging 0.86
R0357:Catsperg2 UTSW 7 29,414,326 (GRCm39) missense possibly damaging 0.93
R0480:Catsperg2 UTSW 7 29,420,723 (GRCm39) missense probably damaging 0.98
R0578:Catsperg2 UTSW 7 29,404,116 (GRCm39) missense possibly damaging 0.71
R0732:Catsperg2 UTSW 7 29,400,121 (GRCm39) missense probably damaging 1.00
R0826:Catsperg2 UTSW 7 29,405,049 (GRCm39) missense possibly damaging 0.92
R1535:Catsperg2 UTSW 7 29,397,671 (GRCm39) missense possibly damaging 0.85
R1925:Catsperg2 UTSW 7 29,397,189 (GRCm39) missense probably benign 0.01
R1990:Catsperg2 UTSW 7 29,420,470 (GRCm39) nonsense probably null
R3433:Catsperg2 UTSW 7 29,400,643 (GRCm39) missense possibly damaging 0.71
R3721:Catsperg2 UTSW 7 29,404,527 (GRCm39) missense probably benign 0.02
R4020:Catsperg2 UTSW 7 29,416,429 (GRCm39) missense probably damaging 0.99
R4760:Catsperg2 UTSW 7 29,405,060 (GRCm39) missense probably damaging 0.99
R4829:Catsperg2 UTSW 7 29,400,550 (GRCm39) missense probably damaging 0.98
R5033:Catsperg2 UTSW 7 29,409,559 (GRCm39) missense possibly damaging 0.93
R5093:Catsperg2 UTSW 7 29,416,423 (GRCm39) missense probably benign 0.32
R5266:Catsperg2 UTSW 7 29,416,491 (GRCm39) missense probably damaging 0.98
R5267:Catsperg2 UTSW 7 29,416,491 (GRCm39) missense probably damaging 0.98
R5287:Catsperg2 UTSW 7 29,397,263 (GRCm39) missense possibly damaging 0.96
R5427:Catsperg2 UTSW 7 29,414,275 (GRCm39) missense possibly damaging 0.71
R5575:Catsperg2 UTSW 7 29,405,015 (GRCm39) missense possibly damaging 0.84
R5685:Catsperg2 UTSW 7 29,400,613 (GRCm39) missense probably damaging 1.00
R5844:Catsperg2 UTSW 7 29,397,257 (GRCm39) missense possibly damaging 0.96
R5982:Catsperg2 UTSW 7 29,412,442 (GRCm39) missense possibly damaging 0.51
R6662:Catsperg2 UTSW 7 29,418,938 (GRCm39) start gained probably benign
R6744:Catsperg2 UTSW 7 29,409,244 (GRCm39) missense probably benign 0.23
R7171:Catsperg2 UTSW 7 29,404,750 (GRCm39) missense possibly damaging 0.71
R7239:Catsperg2 UTSW 7 29,409,507 (GRCm39) missense probably benign 0.00
R7336:Catsperg2 UTSW 7 29,406,026 (GRCm39) missense possibly damaging 0.83
R7498:Catsperg2 UTSW 7 29,416,527 (GRCm39) missense possibly damaging 0.71
R7548:Catsperg2 UTSW 7 29,409,251 (GRCm39) missense probably benign 0.32
R7562:Catsperg2 UTSW 7 29,397,144 (GRCm39) missense probably benign 0.18
R7565:Catsperg2 UTSW 7 29,412,406 (GRCm39) missense probably null 0.71
R7600:Catsperg2 UTSW 7 29,404,283 (GRCm39) missense probably benign 0.32
R8460:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8461:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8751:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8752:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8829:Catsperg2 UTSW 7 29,397,269 (GRCm39) missense probably benign 0.33
R8832:Catsperg2 UTSW 7 29,397,269 (GRCm39) missense probably benign 0.33
R9284:Catsperg2 UTSW 7 29,405,006 (GRCm39) critical splice donor site probably null
R9468:Catsperg2 UTSW 7 29,409,432 (GRCm39) critical splice donor site probably null
Z1177:Catsperg2 UTSW 7 29,397,207 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAATGAAGGAGGTCCGCTTG -3'
(R):5'- AGACTGGAAGTGTGGCTCTG -3'

Sequencing Primer
(F):5'- AGGTCCGCTTGCTGCTGAG -3'
(R):5'- GAATGCTTGCCTAACTCTCATGAGG -3'
Posted On 2022-03-25