Mutagenetix > Incidental Mutation

Incidental Mutation 'R9264:Catsperg2'

702423

Institutional Source

Beutler Lab

Gene Symbol

Catsperg2

Ensembl Gene

ENSMUSG00000049123

Gene Name

cation channel sperm associated auxiliary subunit gamma 2

Synonyms

1700067C01Rik, CATSPERG

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R9264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29697219-29727032 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 29698188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1033 (N1033K)

Ref Sequence

ENSEMBL: ENSMUSP00000147099 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061193] [ENSMUST00000207115] [ENSMUST00000208371] [ENSMUST00000208607] [ENSMUST00000209126]

AlphaFold

C6KI89

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061193
AA Change: N1033K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000052285
Gene: ENSMUSG00000049123
AA Change: N1033K

Domain	Start	End	E-Value	Type
Pfam:CATSPERG	2	973	N/A	PFAM
transmembrane domain	1065	1087	N/A	INTRINSIC
low complexity region	1106	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207115

Predicted Effect

probably benign
Transcript: ENSMUST00000208371

Predicted Effect

probably benign
Transcript: ENSMUST00000208607

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209126
AA Change: N1033K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

Meta Mutation Damage Score

0.4777

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,116,466	M1L	probably benign	Het
Abca15	A	T	7: 120,401,833	I1531L	probably benign	Het
Adam28	T	C	14: 68,607,465	Y791C	probably benign	Het
Ankrd40	T	A	11: 94,338,361	I262N	probably damaging	Het
BC067074	G	A	13: 113,319,480	V687M		Het
Cdh10	A	T	15: 18,963,995	D81V	probably damaging	Het
Cep290	T	C	10: 100,498,016	V310A	possibly damaging	Het
Cep78	T	C	19: 15,974,466	Y325C	probably damaging	Het
Clstn3	T	A	6: 124,459,768	D197V	probably damaging	Het
Col11a1	T	C	3: 114,212,160	I1647T	unknown	Het
Col5a1	G	A	2: 27,964,111	R569K	unknown	Het
Cyp4a10	T	C	4: 115,524,278	S180P	probably benign	Het
D630045J12Rik	T	C	6: 38,158,238	I1336V	probably benign	Het
Dchs2	G	A	3: 83,270,477	V946M	probably damaging	Het
Dnah10	A	G	5: 124,736,836	R347G	probably damaging	Het
Dnah11	T	A	12: 118,027,527	D2368V	probably damaging	Het
Ganab	T	C	19: 8,912,864	I719T	possibly damaging	Het
Gm10944	C	A	10: 10,681,839	A11D	unknown	Het
Gmcl1	T	C	6: 86,714,213	M267V	probably benign	Het
Inhbe	T	A	10: 127,350,558	D251V	probably damaging	Het
Kcnj1	G	A	9: 32,396,358	R26Q	probably benign	Het
Lama5	A	G	2: 180,196,478		probably benign	Het
Lin9	T	A	1: 180,667,347	D251E	probably damaging	Het
Magel2	T	A	7: 62,378,596	I416N	possibly damaging	Het
Mdga2	T	C	12: 66,513,283	N772S	probably damaging	Het
Msh3	G	T	13: 92,349,304	Q171K	probably benign	Het
Mslnl	T	G	17: 25,742,532		probably benign	Het
Mtpn	A	G	6: 35,512,241	L116P	possibly damaging	Het
Myh7	T	C	14: 54,975,997	T1351A	probably benign	Het
Nectin3	A	T	16: 46,454,635	I353N	probably damaging	Het
Nprl3	A	T	11: 32,233,948	N500K	probably benign	Het
Nup93	T	A	8: 94,292,720	I181N	probably benign	Het
Olfr1198	T	C	2: 88,746,432	H152R	probably damaging	Het
Olfr362	G	A	2: 37,104,789	T287I	probably damaging	Het
Optc	T	C	1: 133,905,240	I41V	probably benign	Het
Pcdh7	C	A	5: 58,129,321	N1246K	probably benign	Het
Pcdhb3	T	A	18: 37,302,113	D377E	probably benign	Het
Pnpla6	C	T	8: 3,523,294	P386L	probably benign	Het
Polr3a	T	C	14: 24,470,831	T587A	probably benign	Het
Pramel1	T	G	4: 143,398,529	L341R	probably damaging	Het
Rhot2	A	T	17: 25,841,766	N210K	probably damaging	Het
Slc37a1	A	G	17: 31,300,485	I12V	probably benign	Het
Spata48	T	A	11: 11,464,678	D141E		Het
Sstr3	G	T	15: 78,539,592	N318K	probably damaging	Het
Ssx2ip	T	C	3: 146,437,200	V511A	probably benign	Het
Stfa1	G	A	16: 36,280,568	V57I	unknown	Het
Syne1	T	G	10: 5,262,793	R3265S	probably damaging	Het
Tacc2	G	T	7: 130,626,803	K1739N	probably damaging	Het
Tas2r143	A	T	6: 42,400,739	M168L	probably benign	Het
Tm4sf1	A	T	3: 57,294,610		probably null	Het
Ttc16	A	G	2: 32,763,005	I604T	possibly damaging	Het
Ugt1a10	T	A	1: 88,055,671	W64R	possibly damaging	Het
Usp34	A	T	11: 23,489,064	H3561L		Het
Vasp	C	T	7: 19,259,451	V276I	unknown	Het
Vwa3a	A	G	7: 120,775,464	N333S	probably benign	Het
Wipf3	A	G	6: 54,483,881	N105D	probably benign	Het
Zfp760	T	C	17: 21,723,682	S613P	possibly damaging	Het

Other mutations in Catsperg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Catsperg2	APN	7	29705404	missense	possibly damaging	0.86
IGL00095:Catsperg2	APN	7	29698058	missense	possibly damaging	0.73
IGL00902:Catsperg2	APN	7	29701143	missense	possibly damaging	0.93
IGL01667:Catsperg2	APN	7	29710133	missense	probably damaging	0.98
IGL01791:Catsperg2	APN	7	29704665	splice site	probably null
IGL01961:Catsperg2	APN	7	29721672	splice site	probably benign
IGL02187:Catsperg2	APN	7	29721366	missense	probably benign	0.02
IGL02605:Catsperg2	APN	7	29719565	missense	possibly damaging	0.71
IGL03001:Catsperg2	APN	7	29725079	missense	probably benign	0.32
IGL03228:Catsperg2	APN	7	29698225	missense	probably damaging	0.96
IGL03239:Catsperg2	APN	7	29697716	missense	probably benign	0.04
IGL03242:Catsperg2	APN	7	29725479	unclassified	probably benign
IGL03247:Catsperg2	APN	7	29717048	missense	possibly damaging	0.71
IGL03256:Catsperg2	APN	7	29709874	missense	probably damaging	0.99
PIT4520001:Catsperg2	UTSW	7	29710161	missense	possibly damaging	0.93
R0052:Catsperg2	UTSW	7	29725020	splice site	probably benign
R0281:Catsperg2	UTSW	7	29706571	missense	possibly damaging	0.86
R0357:Catsperg2	UTSW	7	29714901	missense	possibly damaging	0.93
R0480:Catsperg2	UTSW	7	29721298	missense	probably damaging	0.98
R0578:Catsperg2	UTSW	7	29704691	missense	possibly damaging	0.71
R0732:Catsperg2	UTSW	7	29700696	missense	probably damaging	1.00
R0826:Catsperg2	UTSW	7	29705624	missense	possibly damaging	0.92
R1535:Catsperg2	UTSW	7	29698246	missense	possibly damaging	0.85
R1925:Catsperg2	UTSW	7	29697764	missense	probably benign	0.01
R1990:Catsperg2	UTSW	7	29721045	nonsense	probably null
R3433:Catsperg2	UTSW	7	29701218	missense	possibly damaging	0.71
R3721:Catsperg2	UTSW	7	29705102	missense	probably benign	0.02
R4020:Catsperg2	UTSW	7	29717004	missense	probably damaging	0.99
R4760:Catsperg2	UTSW	7	29705635	missense	probably damaging	0.99
R4829:Catsperg2	UTSW	7	29701125	missense	probably damaging	0.98
R5033:Catsperg2	UTSW	7	29710134	missense	possibly damaging	0.93
R5093:Catsperg2	UTSW	7	29716998	missense	probably benign	0.32
R5266:Catsperg2	UTSW	7	29717066	missense	probably damaging	0.98
R5267:Catsperg2	UTSW	7	29717066	missense	probably damaging	0.98
R5287:Catsperg2	UTSW	7	29697838	missense	possibly damaging	0.96
R5427:Catsperg2	UTSW	7	29714850	missense	possibly damaging	0.71
R5575:Catsperg2	UTSW	7	29705590	missense	possibly damaging	0.84
R5685:Catsperg2	UTSW	7	29701188	missense	probably damaging	1.00
R5844:Catsperg2	UTSW	7	29697832	missense	possibly damaging	0.96
R5982:Catsperg2	UTSW	7	29713017	missense	possibly damaging	0.51
R6662:Catsperg2	UTSW	7	29719513	start gained	probably benign
R6744:Catsperg2	UTSW	7	29709819	missense	probably benign	0.23
R7171:Catsperg2	UTSW	7	29705325	missense	possibly damaging	0.71
R7239:Catsperg2	UTSW	7	29710082	missense	probably benign	0.00
R7336:Catsperg2	UTSW	7	29706601	missense	possibly damaging	0.83
R7498:Catsperg2	UTSW	7	29717102	missense	possibly damaging	0.71
R7548:Catsperg2	UTSW	7	29709826	missense	probably benign	0.32
R7562:Catsperg2	UTSW	7	29697719	missense	probably benign	0.18
R7565:Catsperg2	UTSW	7	29712981	missense	probably null	0.71
R7600:Catsperg2	UTSW	7	29704858	missense	probably benign	0.32
R8460:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8461:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8751:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8752:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8829:Catsperg2	UTSW	7	29697844	missense	probably benign	0.33
R8832:Catsperg2	UTSW	7	29697844	missense	probably benign	0.33
R9284:Catsperg2	UTSW	7	29705581	critical splice donor site	probably null
R9468:Catsperg2	UTSW	7	29710007	critical splice donor site	probably null
Z1177:Catsperg2	UTSW	7	29697782	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ACAATGAAGGAGGTCCGCTTG -3'
(R):5'- AGACTGGAAGTGTGGCTCTG -3'

Sequencing Primer
(F):5'- AGGTCCGCTTGCTGCTGAG -3'
(R):5'- GAATGCTTGCCTAACTCTCATGAGG -3'

Posted On

2022-03-25