Incidental Mutation 'R9264:Abca15'
ID 702425
Institutional Source Beutler Lab
Gene Symbol Abca15
Ensembl Gene ENSMUSG00000054746
Gene Name ATP-binding cassette, sub-family A member 15
Synonyms 4930500I12Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119927893-120006910 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120001056 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1531 (I1531L)
Ref Sequence ENSEMBL: ENSMUSP00000075621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076272] [ENSMUST00000121265]
AlphaFold E9PWH4
Predicted Effect probably benign
Transcript: ENSMUST00000076272
AA Change: I1531L

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075621
Gene: ENSMUSG00000054746
AA Change: I1531L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 5.7e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 892 1293 7.9e-24 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121265
AA Change: I1531L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112821
Gene: ENSMUSG00000054746
AA Change: I1531L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 2.1e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 907 1293 1e-25 PFAM
AAA 1381 1565 1.16e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI

All alleles(2) : Targeted(2

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Abca15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca15 APN 7 119,996,277 (GRCm39) missense probably damaging 1.00
IGL00505:Abca15 APN 7 119,968,459 (GRCm39) critical splice donor site probably null
IGL00851:Abca15 APN 7 119,939,230 (GRCm39) missense probably damaging 1.00
IGL00985:Abca15 APN 7 119,996,241 (GRCm39) missense probably damaging 1.00
IGL01114:Abca15 APN 7 119,960,643 (GRCm39) missense probably damaging 0.99
IGL01287:Abca15 APN 7 119,932,081 (GRCm39) utr 3 prime probably benign
IGL01333:Abca15 APN 7 119,981,531 (GRCm39) missense probably damaging 1.00
IGL01482:Abca15 APN 7 119,981,969 (GRCm39) missense probably benign 0.00
IGL01610:Abca15 APN 7 119,939,867 (GRCm39) missense probably damaging 0.98
IGL02238:Abca15 APN 7 119,995,829 (GRCm39) missense probably benign 0.02
IGL02377:Abca15 APN 7 119,965,133 (GRCm39) splice site probably benign
IGL02666:Abca15 APN 7 119,934,431 (GRCm39) missense probably damaging 1.00
IGL02836:Abca15 APN 7 119,987,439 (GRCm39) missense probably benign
IGL03337:Abca15 APN 7 119,995,930 (GRCm39) missense probably benign 0.24
IGL03354:Abca15 APN 7 119,993,711 (GRCm39) nonsense probably null
H8562:Abca15 UTSW 7 119,974,077 (GRCm39) splice site probably benign
IGL03098:Abca15 UTSW 7 119,987,499 (GRCm39) splice site probably null
R0029:Abca15 UTSW 7 119,945,225 (GRCm39) missense probably benign 0.01
R0029:Abca15 UTSW 7 119,945,225 (GRCm39) missense probably benign 0.01
R0076:Abca15 UTSW 7 119,972,908 (GRCm39) splice site probably benign
R0165:Abca15 UTSW 7 119,950,126 (GRCm39) splice site probably benign
R0311:Abca15 UTSW 7 120,002,127 (GRCm39) missense probably damaging 0.98
R0387:Abca15 UTSW 7 119,932,075 (GRCm39) critical splice donor site probably null
R0610:Abca15 UTSW 7 119,965,009 (GRCm39) missense possibly damaging 0.75
R0612:Abca15 UTSW 7 119,936,478 (GRCm39) missense probably damaging 1.00
R0704:Abca15 UTSW 7 119,953,746 (GRCm39) missense probably damaging 0.98
R0890:Abca15 UTSW 7 119,972,936 (GRCm39) missense probably benign 0.01
R0961:Abca15 UTSW 7 119,960,208 (GRCm39) nonsense probably null
R1144:Abca15 UTSW 7 119,960,083 (GRCm39) splice site probably benign
R1412:Abca15 UTSW 7 119,944,546 (GRCm39) missense possibly damaging 0.93
R1419:Abca15 UTSW 7 119,974,125 (GRCm39) missense probably benign 0.10
R1467:Abca15 UTSW 7 119,939,761 (GRCm39) splice site probably null
R1467:Abca15 UTSW 7 119,939,761 (GRCm39) splice site probably null
R1469:Abca15 UTSW 7 119,981,720 (GRCm39) missense probably benign 0.00
R1469:Abca15 UTSW 7 119,981,720 (GRCm39) missense probably benign 0.00
R1493:Abca15 UTSW 7 119,981,513 (GRCm39) missense probably benign 0.00
R1513:Abca15 UTSW 7 119,939,322 (GRCm39) missense probably damaging 0.96
R1702:Abca15 UTSW 7 119,981,925 (GRCm39) missense probably benign 0.10
R1857:Abca15 UTSW 7 119,960,592 (GRCm39) missense probably damaging 1.00
R1893:Abca15 UTSW 7 119,939,776 (GRCm39) missense possibly damaging 0.85
R1901:Abca15 UTSW 7 119,945,322 (GRCm39) missense probably damaging 1.00
R1951:Abca15 UTSW 7 119,960,655 (GRCm39) missense probably damaging 1.00
R1953:Abca15 UTSW 7 119,960,655 (GRCm39) missense probably damaging 1.00
R1962:Abca15 UTSW 7 119,940,468 (GRCm39) missense probably damaging 1.00
R2063:Abca15 UTSW 7 119,960,127 (GRCm39) missense possibly damaging 0.61
R2141:Abca15 UTSW 7 120,006,697 (GRCm39) missense probably damaging 1.00
R2145:Abca15 UTSW 7 119,953,701 (GRCm39) missense probably benign 0.08
R2182:Abca15 UTSW 7 119,939,450 (GRCm39) nonsense probably null
R2425:Abca15 UTSW 7 119,959,033 (GRCm39) missense probably damaging 1.00
R2444:Abca15 UTSW 7 119,965,120 (GRCm39) missense probably damaging 1.00
R3023:Abca15 UTSW 7 119,982,002 (GRCm39) missense probably benign 0.40
R3079:Abca15 UTSW 7 119,984,392 (GRCm39) missense probably damaging 1.00
R3106:Abca15 UTSW 7 119,995,856 (GRCm39) missense possibly damaging 0.63
R3622:Abca15 UTSW 7 119,950,036 (GRCm39) nonsense probably null
R4085:Abca15 UTSW 7 119,981,949 (GRCm39) missense probably damaging 1.00
R4233:Abca15 UTSW 7 120,002,202 (GRCm39) nonsense probably null
R4591:Abca15 UTSW 7 119,981,636 (GRCm39) missense probably damaging 1.00
R4612:Abca15 UTSW 7 119,934,384 (GRCm39) missense probably benign 0.03
R4721:Abca15 UTSW 7 119,949,998 (GRCm39) missense probably benign 0.01
R4838:Abca15 UTSW 7 119,944,523 (GRCm39) missense probably benign 0.00
R4940:Abca15 UTSW 7 119,931,917 (GRCm39) missense probably benign
R4963:Abca15 UTSW 7 119,960,142 (GRCm39) missense probably damaging 1.00
R4993:Abca15 UTSW 7 120,000,941 (GRCm39) missense probably damaging 0.99
R5022:Abca15 UTSW 7 119,945,319 (GRCm39) missense probably damaging 0.98
R5030:Abca15 UTSW 7 119,939,224 (GRCm39) missense probably damaging 1.00
R5072:Abca15 UTSW 7 120,006,198 (GRCm39) missense probably damaging 1.00
R5090:Abca15 UTSW 7 119,984,422 (GRCm39) missense probably damaging 1.00
R5309:Abca15 UTSW 7 119,944,592 (GRCm39) missense probably damaging 0.96
R5310:Abca15 UTSW 7 119,931,839 (GRCm39) missense possibly damaging 0.46
R5312:Abca15 UTSW 7 119,944,592 (GRCm39) missense probably damaging 0.96
R5482:Abca15 UTSW 7 119,968,370 (GRCm39) missense probably damaging 1.00
R5596:Abca15 UTSW 7 120,000,972 (GRCm39) missense possibly damaging 0.94
R5853:Abca15 UTSW 7 119,939,806 (GRCm39) missense probably benign 0.00
R5950:Abca15 UTSW 7 119,981,879 (GRCm39) missense probably damaging 1.00
R5953:Abca15 UTSW 7 119,960,241 (GRCm39) missense probably damaging 1.00
R6072:Abca15 UTSW 7 119,987,481 (GRCm39) missense probably damaging 0.98
R6131:Abca15 UTSW 7 119,939,428 (GRCm39) missense probably benign 0.03
R6132:Abca15 UTSW 7 119,960,643 (GRCm39) missense probably benign 0.14
R6136:Abca15 UTSW 7 119,939,272 (GRCm39) missense possibly damaging 0.81
R6207:Abca15 UTSW 7 119,973,017 (GRCm39) missense probably benign 0.01
R6315:Abca15 UTSW 7 119,945,315 (GRCm39) missense probably damaging 1.00
R6417:Abca15 UTSW 7 119,996,351 (GRCm39) missense possibly damaging 0.95
R6420:Abca15 UTSW 7 119,996,351 (GRCm39) missense possibly damaging 0.95
R6595:Abca15 UTSW 7 119,993,710 (GRCm39) missense probably benign 0.00
R6653:Abca15 UTSW 7 119,945,229 (GRCm39) missense probably benign 0.03
R6859:Abca15 UTSW 7 120,002,217 (GRCm39) nonsense probably null
R6983:Abca15 UTSW 7 119,953,686 (GRCm39) missense probably benign 0.26
R7127:Abca15 UTSW 7 119,931,825 (GRCm39) missense probably benign 0.06
R7205:Abca15 UTSW 7 119,993,587 (GRCm39) missense possibly damaging 0.89
R7336:Abca15 UTSW 7 119,987,456 (GRCm39) missense possibly damaging 0.66
R7426:Abca15 UTSW 7 119,945,221 (GRCm39) missense possibly damaging 0.88
R7745:Abca15 UTSW 7 119,931,440 (GRCm39) missense probably damaging 1.00
R7751:Abca15 UTSW 7 119,965,044 (GRCm39) missense possibly damaging 0.72
R7806:Abca15 UTSW 7 119,932,059 (GRCm39) missense probably damaging 0.96
R8042:Abca15 UTSW 7 120,002,233 (GRCm39) missense possibly damaging 0.95
R8098:Abca15 UTSW 7 119,960,619 (GRCm39) missense probably benign 0.09
R8153:Abca15 UTSW 7 119,999,812 (GRCm39) missense probably damaging 1.00
R8247:Abca15 UTSW 7 119,936,445 (GRCm39) missense possibly damaging 0.83
R8259:Abca15 UTSW 7 119,939,422 (GRCm39) missense probably benign 0.00
R8272:Abca15 UTSW 7 120,006,665 (GRCm39) missense probably damaging 1.00
R8295:Abca15 UTSW 7 119,974,188 (GRCm39) missense probably benign 0.00
R8757:Abca15 UTSW 7 120,006,631 (GRCm39) missense probably damaging 0.96
R8759:Abca15 UTSW 7 120,006,631 (GRCm39) missense probably damaging 0.96
R8905:Abca15 UTSW 7 119,960,771 (GRCm39) missense probably benign 0.28
R9145:Abca15 UTSW 7 119,987,388 (GRCm39) missense probably benign 0.13
R9217:Abca15 UTSW 7 119,987,439 (GRCm39) missense probably benign
R9517:Abca15 UTSW 7 119,987,424 (GRCm39) missense probably benign 0.07
RF018:Abca15 UTSW 7 119,993,683 (GRCm39) missense possibly damaging 0.50
Z1176:Abca15 UTSW 7 119,981,728 (GRCm39) missense probably damaging 0.99
Z1176:Abca15 UTSW 7 119,945,249 (GRCm39) missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AGTCTCAGTACTAAGAGGTGTTTG -3'
(R):5'- TCTGAGGATTCTTGGCTATTCC -3'

Sequencing Primer
(F):5'- CTCAGTACTAAGAGGTGTTTGTTATC -3'
(R):5'- ATTCTTGGCTATTCCATTTATTAGGG -3'
Posted On 2022-03-25