Incidental Mutation 'R9264:Vwa3a'
ID 702426
Institutional Source Beutler Lab
Gene Symbol Vwa3a
Ensembl Gene ENSMUSG00000030889
Gene Name von Willebrand factor A domain containing 3A
Synonyms E030013G06Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 120338541-120404965 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120374687 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 333 (N333S)
Ref Sequence ENSEMBL: ENSMUSP00000129136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033180] [ENSMUST00000166668] [ENSMUST00000167213] [ENSMUST00000168600]
AlphaFold Q3UVV9
Predicted Effect probably benign
Transcript: ENSMUST00000033180
AA Change: N333S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033180
Gene: ENSMUSG00000030889
AA Change: N333S

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 6.3e-30 PFAM
Pfam:VWA_3 483 634 1.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166668
AA Change: N333S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129136
Gene: ENSMUSG00000030889
AA Change: N333S

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167213
AA Change: N333S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133029
Gene: ENSMUSG00000030889
AA Change: N333S

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168600
AA Change: N333S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000132372
Gene: ENSMUSG00000030889
AA Change: N333S

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 8.3e-29 PFAM
Pfam:VWA_3 483 609 5.3e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Vwa3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Vwa3a APN 7 120,383,197 (GRCm39) missense probably benign 0.09
IGL01807:Vwa3a APN 7 120,374,729 (GRCm39) splice site probably null
IGL02850:Vwa3a APN 7 120,372,515 (GRCm39) missense probably benign 0.00
IGL03253:Vwa3a APN 7 120,378,092 (GRCm39) missense probably benign 0.03
PIT4812001:Vwa3a UTSW 7 120,375,356 (GRCm39) missense probably damaging 1.00
R0026:Vwa3a UTSW 7 120,379,434 (GRCm39) missense probably damaging 1.00
R0114:Vwa3a UTSW 7 120,374,603 (GRCm39) missense probably benign 0.06
R1145:Vwa3a UTSW 7 120,392,566 (GRCm39) missense probably damaging 0.99
R1145:Vwa3a UTSW 7 120,392,566 (GRCm39) missense probably damaging 0.99
R1306:Vwa3a UTSW 7 120,399,613 (GRCm39) missense possibly damaging 0.49
R1355:Vwa3a UTSW 7 120,383,334 (GRCm39) missense probably damaging 1.00
R1412:Vwa3a UTSW 7 120,379,377 (GRCm39) missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120,367,388 (GRCm39) missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120,367,388 (GRCm39) missense probably damaging 1.00
R1584:Vwa3a UTSW 7 120,367,388 (GRCm39) missense probably damaging 1.00
R1686:Vwa3a UTSW 7 120,379,371 (GRCm39) missense probably damaging 1.00
R1710:Vwa3a UTSW 7 120,403,254 (GRCm39) splice site probably null
R1717:Vwa3a UTSW 7 120,392,609 (GRCm39) missense probably benign
R1834:Vwa3a UTSW 7 120,389,359 (GRCm39) missense probably benign 0.06
R1912:Vwa3a UTSW 7 120,394,850 (GRCm39) missense probably damaging 1.00
R1970:Vwa3a UTSW 7 120,379,394 (GRCm39) missense probably damaging 1.00
R1978:Vwa3a UTSW 7 120,358,177 (GRCm39) missense probably null 0.00
R2034:Vwa3a UTSW 7 120,381,868 (GRCm39) nonsense probably null
R2059:Vwa3a UTSW 7 120,358,172 (GRCm39) missense probably damaging 0.98
R2120:Vwa3a UTSW 7 120,391,641 (GRCm39) missense probably benign
R2408:Vwa3a UTSW 7 120,372,517 (GRCm39) missense probably benign 0.00
R3423:Vwa3a UTSW 7 120,398,334 (GRCm39) missense probably damaging 1.00
R3744:Vwa3a UTSW 7 120,351,817 (GRCm39) missense probably benign
R3816:Vwa3a UTSW 7 120,399,602 (GRCm39) missense probably benign 0.29
R3849:Vwa3a UTSW 7 120,361,687 (GRCm39) nonsense probably null
R3904:Vwa3a UTSW 7 120,358,099 (GRCm39) missense probably benign
R4031:Vwa3a UTSW 7 120,367,455 (GRCm39) critical splice donor site probably null
R4408:Vwa3a UTSW 7 120,378,149 (GRCm39) missense probably benign 0.16
R4628:Vwa3a UTSW 7 120,392,598 (GRCm39) missense probably benign 0.05
R4629:Vwa3a UTSW 7 120,392,598 (GRCm39) missense probably benign 0.05
R4652:Vwa3a UTSW 7 120,378,138 (GRCm39) missense probably damaging 0.96
R4884:Vwa3a UTSW 7 120,390,924 (GRCm39) missense probably benign
R4948:Vwa3a UTSW 7 120,375,487 (GRCm39) missense probably damaging 0.98
R5112:Vwa3a UTSW 7 120,383,208 (GRCm39) missense probably damaging 1.00
R5385:Vwa3a UTSW 7 120,389,365 (GRCm39) missense possibly damaging 0.91
R5386:Vwa3a UTSW 7 120,389,365 (GRCm39) missense possibly damaging 0.91
R5579:Vwa3a UTSW 7 120,367,396 (GRCm39) missense probably benign 0.29
R5587:Vwa3a UTSW 7 120,379,458 (GRCm39) missense probably damaging 1.00
R5639:Vwa3a UTSW 7 120,389,366 (GRCm39) missense probably damaging 0.99
R6102:Vwa3a UTSW 7 120,375,361 (GRCm39) splice site probably null
R6239:Vwa3a UTSW 7 120,393,457 (GRCm39) missense probably benign 0.00
R6279:Vwa3a UTSW 7 120,381,623 (GRCm39) missense probably damaging 0.98
R6298:Vwa3a UTSW 7 120,394,874 (GRCm39) missense probably benign 0.01
R6300:Vwa3a UTSW 7 120,381,623 (GRCm39) missense probably damaging 0.98
R6336:Vwa3a UTSW 7 120,361,646 (GRCm39) missense possibly damaging 0.93
R6907:Vwa3a UTSW 7 120,391,804 (GRCm39) unclassified probably benign
R7135:Vwa3a UTSW 7 120,372,253 (GRCm39) missense possibly damaging 0.69
R7215:Vwa3a UTSW 7 120,394,853 (GRCm39) missense possibly damaging 0.83
R7282:Vwa3a UTSW 7 120,385,688 (GRCm39) missense probably benign 0.03
R7351:Vwa3a UTSW 7 120,375,559 (GRCm39) missense probably damaging 0.99
R7406:Vwa3a UTSW 7 120,378,138 (GRCm39) missense probably damaging 0.96
R7557:Vwa3a UTSW 7 120,394,841 (GRCm39) missense possibly damaging 0.90
R7612:Vwa3a UTSW 7 120,351,838 (GRCm39) missense probably null 0.47
R7699:Vwa3a UTSW 7 120,351,841 (GRCm39) missense probably damaging 1.00
R7823:Vwa3a UTSW 7 120,372,185 (GRCm39) missense probably damaging 1.00
R8074:Vwa3a UTSW 7 120,398,321 (GRCm39) missense probably benign 0.00
R8730:Vwa3a UTSW 7 120,381,910 (GRCm39) missense probably damaging 0.97
R8768:Vwa3a UTSW 7 120,375,299 (GRCm39) missense probably damaging 1.00
R8941:Vwa3a UTSW 7 120,375,311 (GRCm39) missense probably benign 0.00
R9116:Vwa3a UTSW 7 120,366,470 (GRCm39) missense
R9134:Vwa3a UTSW 7 120,377,659 (GRCm39) missense probably damaging 0.96
R9450:Vwa3a UTSW 7 120,403,253 (GRCm39) critical splice donor site probably null
R9464:Vwa3a UTSW 7 120,385,682 (GRCm39) missense possibly damaging 0.84
R9792:Vwa3a UTSW 7 120,383,307 (GRCm39) missense probably damaging 1.00
R9793:Vwa3a UTSW 7 120,383,307 (GRCm39) missense probably damaging 1.00
V7732:Vwa3a UTSW 7 120,378,172 (GRCm39) splice site probably benign
X0019:Vwa3a UTSW 7 120,367,432 (GRCm39) missense probably damaging 0.99
Z1177:Vwa3a UTSW 7 120,358,356 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTGACTTGGCTGCTTGC -3'
(R):5'- AGTGAAAGTGACCAGTCCCC -3'

Sequencing Primer
(F):5'- GCCTTCTCTTACCTTGGCAACG -3'
(R):5'- TAGGGAGCCTTGAACTGACC -3'
Posted On 2022-03-25