Incidental Mutation 'R9264:Pnpla6'
ID 702428
Institutional Source Beutler Lab
Gene Symbol Pnpla6
Ensembl Gene ENSMUSG00000004565
Gene Name patatin-like phospholipase domain containing 6
Synonyms Nte, Swiss-cheese, MSws
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 3565384-3594267 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3573294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 386 (P386L)
Ref Sequence ENSEMBL: ENSMUSP00000146680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000111070] [ENSMUST00000207424] [ENSMUST00000207941] [ENSMUST00000208002] [ENSMUST00000208762]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000004681
AA Change: P364L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: P364L

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111070
AA Change: P364L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: P364L

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207424
Predicted Effect probably benign
Transcript: ENSMUST00000207941
AA Change: P396L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208002
AA Change: P386L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208762
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Pnpla6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pnpla6 APN 8 3,573,808 (GRCm39) missense probably damaging 1.00
IGL00820:Pnpla6 APN 8 3,582,358 (GRCm39) missense possibly damaging 0.95
IGL00839:Pnpla6 APN 8 3,592,299 (GRCm39) missense probably benign 0.05
IGL01732:Pnpla6 APN 8 3,572,616 (GRCm39) missense probably damaging 0.99
IGL01973:Pnpla6 APN 8 3,567,619 (GRCm39) missense probably damaging 1.00
IGL02267:Pnpla6 APN 8 3,567,327 (GRCm39) missense probably benign 0.00
IGL03246:Pnpla6 APN 8 3,581,530 (GRCm39) missense probably benign 0.01
IGL03286:Pnpla6 APN 8 3,581,473 (GRCm39) missense probably damaging 0.99
Immemorial UTSW 8 3,581,677 (GRCm39) missense probably benign 0.38
Mammilary UTSW 8 3,571,384 (GRCm39) missense probably benign 0.01
I0000:Pnpla6 UTSW 8 3,592,322 (GRCm39) missense probably benign
R0141:Pnpla6 UTSW 8 3,582,117 (GRCm39) critical splice donor site probably null
R0180:Pnpla6 UTSW 8 3,574,250 (GRCm39) critical splice acceptor site probably null
R0377:Pnpla6 UTSW 8 3,591,501 (GRCm39) missense probably damaging 1.00
R0563:Pnpla6 UTSW 8 3,573,333 (GRCm39) missense possibly damaging 0.51
R0660:Pnpla6 UTSW 8 3,572,269 (GRCm39) unclassified probably benign
R0786:Pnpla6 UTSW 8 3,573,317 (GRCm39) missense probably benign
R0827:Pnpla6 UTSW 8 3,567,618 (GRCm39) missense possibly damaging 0.71
R0882:Pnpla6 UTSW 8 3,567,081 (GRCm39) missense probably damaging 1.00
R1512:Pnpla6 UTSW 8 3,585,459 (GRCm39) splice site probably benign
R1552:Pnpla6 UTSW 8 3,572,403 (GRCm39) missense probably damaging 1.00
R1609:Pnpla6 UTSW 8 3,567,135 (GRCm39) missense probably damaging 1.00
R1770:Pnpla6 UTSW 8 3,584,634 (GRCm39) missense possibly damaging 0.94
R1779:Pnpla6 UTSW 8 3,591,404 (GRCm39) missense probably damaging 1.00
R1987:Pnpla6 UTSW 8 3,592,370 (GRCm39) missense probably benign 0.00
R3079:Pnpla6 UTSW 8 3,591,512 (GRCm39) missense probably benign 0.25
R3125:Pnpla6 UTSW 8 3,584,670 (GRCm39) missense probably null 1.00
R4171:Pnpla6 UTSW 8 3,593,997 (GRCm39) missense probably benign 0.09
R4281:Pnpla6 UTSW 8 3,571,513 (GRCm39) missense probably damaging 1.00
R4674:Pnpla6 UTSW 8 3,571,412 (GRCm39) missense probably damaging 1.00
R4776:Pnpla6 UTSW 8 3,573,818 (GRCm39) missense probably benign 0.01
R4779:Pnpla6 UTSW 8 3,572,838 (GRCm39) missense probably benign 0.00
R5114:Pnpla6 UTSW 8 3,572,613 (GRCm39) missense probably damaging 0.98
R5459:Pnpla6 UTSW 8 3,585,829 (GRCm39) missense probably benign 0.01
R5510:Pnpla6 UTSW 8 3,571,397 (GRCm39) missense probably damaging 0.99
R5538:Pnpla6 UTSW 8 3,581,508 (GRCm39) missense probably benign 0.01
R5664:Pnpla6 UTSW 8 3,587,478 (GRCm39) missense probably damaging 0.98
R6063:Pnpla6 UTSW 8 3,574,156 (GRCm39) missense probably benign 0.21
R6314:Pnpla6 UTSW 8 3,571,572 (GRCm39) missense probably benign 0.39
R6321:Pnpla6 UTSW 8 3,594,015 (GRCm39) missense probably benign
R6454:Pnpla6 UTSW 8 3,587,986 (GRCm39) missense probably damaging 0.99
R6477:Pnpla6 UTSW 8 3,586,627 (GRCm39) missense probably benign 0.00
R6524:Pnpla6 UTSW 8 3,584,519 (GRCm39) splice site probably null
R6809:Pnpla6 UTSW 8 3,584,611 (GRCm39) missense possibly damaging 0.72
R6975:Pnpla6 UTSW 8 3,588,068 (GRCm39) missense probably damaging 1.00
R7293:Pnpla6 UTSW 8 3,588,068 (GRCm39) missense probably damaging 1.00
R7389:Pnpla6 UTSW 8 3,593,981 (GRCm39) nonsense probably null
R7426:Pnpla6 UTSW 8 3,566,540 (GRCm39) splice site probably null
R7520:Pnpla6 UTSW 8 3,587,508 (GRCm39) missense probably damaging 1.00
R7666:Pnpla6 UTSW 8 3,591,591 (GRCm39) missense probably benign 0.01
R7733:Pnpla6 UTSW 8 3,572,660 (GRCm39) missense probably benign 0.01
R7743:Pnpla6 UTSW 8 3,586,594 (GRCm39) missense possibly damaging 0.77
R7744:Pnpla6 UTSW 8 3,581,677 (GRCm39) missense probably benign 0.38
R7923:Pnpla6 UTSW 8 3,581,737 (GRCm39) nonsense probably null
R7980:Pnpla6 UTSW 8 3,586,562 (GRCm39) missense probably damaging 0.97
R8141:Pnpla6 UTSW 8 3,571,384 (GRCm39) missense probably benign 0.01
R8191:Pnpla6 UTSW 8 3,592,382 (GRCm39) missense probably benign 0.12
R8251:Pnpla6 UTSW 8 3,582,399 (GRCm39) missense probably benign 0.29
R8881:Pnpla6 UTSW 8 3,581,489 (GRCm39) missense probably benign 0.00
R8917:Pnpla6 UTSW 8 3,567,637 (GRCm39) missense possibly damaging 0.50
R8939:Pnpla6 UTSW 8 3,571,319 (GRCm39) missense possibly damaging 0.86
R8988:Pnpla6 UTSW 8 3,567,401 (GRCm39) missense possibly damaging 0.51
R9037:Pnpla6 UTSW 8 3,592,379 (GRCm39) nonsense probably null
R9265:Pnpla6 UTSW 8 3,573,294 (GRCm39) missense probably benign
R9386:Pnpla6 UTSW 8 3,571,417 (GRCm39) critical splice donor site probably null
X0018:Pnpla6 UTSW 8 3,567,337 (GRCm39) missense probably damaging 1.00
Z1177:Pnpla6 UTSW 8 3,586,979 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CGGTCAGCATATTTACTCGCTG -3'
(R):5'- GGAGAACAATTGCAGAGCATATCC -3'

Sequencing Primer
(F):5'- CAGCATATTTACTCGCTGAGTCTAG -3'
(R):5'- CCAAGGAAGTAGGATCTATACACTC -3'
Posted On 2022-03-25