Incidental Mutation 'R9264:Nup93'
ID 702429
Institutional Source Beutler Lab
Gene Symbol Nup93
Ensembl Gene ENSMUSG00000032939
Gene Name nucleoporin 93
Synonyms 2410008G02Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.919) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 94941192-95043855 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 95019348 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 181 (I181N)
Ref Sequence ENSEMBL: ENSMUSP00000078878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212824]
AlphaFold Q8BJ71
Predicted Effect probably benign
Transcript: ENSMUST00000079961
AA Change: I181N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: I181N

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 214 804 6.9e-198 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109547
AA Change: I181N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: I181N

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 202 804 8.2e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211822
AA Change: I58N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000212824
AA Change: I181N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Nup93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nup93 APN 8 95,035,651 (GRCm39) critical splice donor site probably null
IGL01652:Nup93 APN 8 95,023,187 (GRCm39) missense possibly damaging 0.93
IGL02003:Nup93 APN 8 95,028,737 (GRCm39) nonsense probably null
IGL02169:Nup93 APN 8 95,028,757 (GRCm39) missense probably damaging 1.00
IGL02212:Nup93 APN 8 95,038,290 (GRCm39) critical splice donor site probably null
IGL02551:Nup93 APN 8 94,954,461 (GRCm39) nonsense probably null
IGL02568:Nup93 APN 8 95,036,263 (GRCm39) missense probably damaging 1.00
IGL03094:Nup93 APN 8 95,023,130 (GRCm39) missense probably benign
IGL03248:Nup93 APN 8 95,032,716 (GRCm39) missense probably damaging 0.98
IGL03273:Nup93 APN 8 95,032,905 (GRCm39) missense probably benign 0.01
IGL03401:Nup93 APN 8 95,036,339 (GRCm39) splice site probably null
PIT4585001:Nup93 UTSW 8 94,970,355 (GRCm39) missense probably benign 0.25
R0409:Nup93 UTSW 8 95,030,293 (GRCm39) missense probably damaging 1.00
R0748:Nup93 UTSW 8 95,034,571 (GRCm39) missense probably damaging 1.00
R0891:Nup93 UTSW 8 95,007,891 (GRCm39) splice site probably benign
R1667:Nup93 UTSW 8 95,019,315 (GRCm39) missense possibly damaging 0.71
R1696:Nup93 UTSW 8 95,023,183 (GRCm39) missense probably benign 0.29
R1862:Nup93 UTSW 8 95,032,730 (GRCm39) missense probably damaging 1.00
R2069:Nup93 UTSW 8 94,970,367 (GRCm39) missense probably damaging 1.00
R2143:Nup93 UTSW 8 95,023,108 (GRCm39) nonsense probably null
R2187:Nup93 UTSW 8 95,027,478 (GRCm39) missense probably damaging 1.00
R2228:Nup93 UTSW 8 95,030,819 (GRCm39) missense probably benign 0.27
R2229:Nup93 UTSW 8 95,030,819 (GRCm39) missense probably benign 0.27
R2254:Nup93 UTSW 8 94,954,485 (GRCm39) critical splice donor site probably null
R2884:Nup93 UTSW 8 95,030,266 (GRCm39) missense probably damaging 1.00
R4521:Nup93 UTSW 8 95,041,264 (GRCm39) missense probably damaging 1.00
R4563:Nup93 UTSW 8 95,034,520 (GRCm39) missense probably damaging 1.00
R4900:Nup93 UTSW 8 95,013,231 (GRCm39) missense probably benign 0.25
R5570:Nup93 UTSW 8 95,041,298 (GRCm39) missense probably damaging 1.00
R6226:Nup93 UTSW 8 95,013,165 (GRCm39) missense probably damaging 1.00
R6489:Nup93 UTSW 8 95,028,716 (GRCm39) missense probably benign 0.10
R6658:Nup93 UTSW 8 95,030,807 (GRCm39) missense probably benign 0.02
R6817:Nup93 UTSW 8 95,041,310 (GRCm39) critical splice donor site probably null
R6895:Nup93 UTSW 8 94,970,314 (GRCm39) missense probably damaging 1.00
R6955:Nup93 UTSW 8 95,036,301 (GRCm39) missense probably damaging 0.96
R7476:Nup93 UTSW 8 95,030,260 (GRCm39) missense probably damaging 1.00
R7643:Nup93 UTSW 8 95,013,247 (GRCm39) critical splice donor site probably null
R7994:Nup93 UTSW 8 95,032,930 (GRCm39) missense probably benign 0.15
R8461:Nup93 UTSW 8 95,007,963 (GRCm39) critical splice donor site probably null
R9177:Nup93 UTSW 8 94,954,371 (GRCm39) missense probably benign 0.25
R9532:Nup93 UTSW 8 95,041,249 (GRCm39) missense probably damaging 1.00
R9567:Nup93 UTSW 8 95,035,604 (GRCm39) missense possibly damaging 0.94
R9629:Nup93 UTSW 8 95,033,267 (GRCm39) missense probably damaging 0.99
R9721:Nup93 UTSW 8 95,030,313 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTTGTAGCAGAGCCTTG -3'
(R):5'- TCCCCGCACTATCTGAGTCATG -3'

Sequencing Primer
(F):5'- TAGCAGAGCCTTGCTGCTG -3'
(R):5'- AGAACAGTTGCATTCATGGTG -3'
Posted On 2022-03-25