Incidental Mutation 'R9264:Kcnj1'
ID 702430
Institutional Source Beutler Lab
Gene Symbol Kcnj1
Ensembl Gene ENSMUSG00000041248
Gene Name potassium inwardly-rectifying channel, subfamily J, member 1
Synonyms ROMK-2, Kir1.1, ROMK
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 32283789-32310493 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32307654 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 26 (R26Q)
Ref Sequence ENSEMBL: ENSMUSP00000131625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047334] [ENSMUST00000172015] [ENSMUST00000213393]
AlphaFold O88335
Predicted Effect probably benign
Transcript: ENSMUST00000047334
AA Change: R6Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046793
Gene: ENSMUSG00000041248
AA Change: R6Q

DomainStartEndE-ValueType
Pfam:IRK 24 361 1.4e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172015
AA Change: R26Q

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000131625
Gene: ENSMUSG00000041248
AA Change: R26Q

DomainStartEndE-ValueType
Pfam:IRK 44 373 7.6e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213393
AA Change: R6Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0666 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null mutation die before weaning with impaired electrolyte, acid-base, and fluid-volume homeostasis, reduced NaCl absorption in the thick ascending limb, and abnormal tubuloglomerular feedback. A colony of mutants with extended suvival serves as a model for Bartter's syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Kcnj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Kcnj1 APN 9 32,307,794 (GRCm39) missense probably benign 0.01
IGL02958:Kcnj1 APN 9 32,307,851 (GRCm39) missense probably damaging 1.00
IGL03285:Kcnj1 APN 9 32,308,157 (GRCm39) missense possibly damaging 0.67
R1179:Kcnj1 UTSW 9 32,308,062 (GRCm39) missense probably damaging 0.96
R1503:Kcnj1 UTSW 9 32,307,788 (GRCm39) missense probably damaging 0.98
R1918:Kcnj1 UTSW 9 32,308,034 (GRCm39) missense probably benign 0.00
R4439:Kcnj1 UTSW 9 32,305,414 (GRCm39) intron probably benign
R4659:Kcnj1 UTSW 9 32,305,444 (GRCm39) missense probably benign
R4661:Kcnj1 UTSW 9 32,307,918 (GRCm39) missense probably benign 0.14
R4917:Kcnj1 UTSW 9 32,308,056 (GRCm39) missense probably damaging 0.99
R4918:Kcnj1 UTSW 9 32,308,056 (GRCm39) missense probably damaging 0.99
R5385:Kcnj1 UTSW 9 32,308,019 (GRCm39) missense probably damaging 1.00
R6017:Kcnj1 UTSW 9 32,305,400 (GRCm39) intron probably benign
R6036:Kcnj1 UTSW 9 32,308,421 (GRCm39) missense probably benign 0.15
R6036:Kcnj1 UTSW 9 32,308,421 (GRCm39) missense probably benign 0.15
R6117:Kcnj1 UTSW 9 32,308,478 (GRCm39) missense probably damaging 1.00
R6245:Kcnj1 UTSW 9 32,308,163 (GRCm39) missense probably damaging 1.00
R6316:Kcnj1 UTSW 9 32,308,632 (GRCm39) missense probably damaging 0.96
R6585:Kcnj1 UTSW 9 32,308,557 (GRCm39) missense probably benign
R6988:Kcnj1 UTSW 9 32,307,881 (GRCm39) missense probably benign 0.17
R7116:Kcnj1 UTSW 9 32,308,277 (GRCm39) missense possibly damaging 0.91
R7393:Kcnj1 UTSW 9 32,308,314 (GRCm39) missense probably damaging 1.00
R7870:Kcnj1 UTSW 9 32,307,881 (GRCm39) missense probably benign 0.17
R8072:Kcnj1 UTSW 9 32,308,593 (GRCm39) missense probably damaging 1.00
R8391:Kcnj1 UTSW 9 32,308,028 (GRCm39) missense probably damaging 1.00
R9418:Kcnj1 UTSW 9 32,308,203 (GRCm39) missense probably damaging 1.00
Z1177:Kcnj1 UTSW 9 32,308,655 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAACAAATGACTTGGTTTGTG -3'
(R):5'- GCTACGACATACCACAGGAG -3'

Sequencing Primer
(F):5'- GGTTTGTGTAAATGATTAACAAGCC -3'
(R):5'- ACTCCCCAAGAAGGCTGTGATG -3'
Posted On 2022-03-25