Mutagenetix > Incidental Mutation

Incidental Mutation 'R9264:Cep290'

702433

Institutional Source

Beutler Lab

Gene Symbol

Cep290

Ensembl Gene

ENSMUSG00000019971

Gene Name

centrosomal protein 290

Synonyms

b2b1454Clo, Nphp6, b2b1752Clo

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R9264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100487558-100574840 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100498016 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 310 (V310A)

Ref Sequence

ENSEMBL: ENSMUSP00000130899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]

AlphaFold

Q6A078

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164751
AA Change: V310A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: V310A

Domain	Start	End	E-Value	Type
coiled coil region	59	298	N/A	INTRINSIC
coiled coil region	319	566	N/A	INTRINSIC
coiled coil region	598	662	N/A	INTRINSIC
coiled coil region	697	754	N/A	INTRINSIC
coiled coil region	780	875	N/A	INTRINSIC
internal_repeat_2	884	894	1.1e-5	PROSPERO
coiled coil region	986	1028	N/A	INTRINSIC
internal_repeat_2	1057	1067	1.1e-5	PROSPERO
coiled coil region	1071	1109	N/A	INTRINSIC
low complexity region	1140	1156	N/A	INTRINSIC
internal_repeat_1	1176	1206	8.72e-8	PROSPERO
coiled coil region	1221	1250	N/A	INTRINSIC
Pfam:CEP209_CC5	1290	1417	3.8e-55	PFAM
low complexity region	1476	1493	N/A	INTRINSIC
internal_repeat_1	1498	1525	8.72e-8	PROSPERO
coiled coil region	1535	1595	N/A	INTRINSIC
coiled coil region	1624	1716	N/A	INTRINSIC
coiled coil region	1776	2328	N/A	INTRINSIC
low complexity region	2333	2347	N/A	INTRINSIC
coiled coil region	2377	2453	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000219765
AA Change: V303A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220346
AA Change: V310A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,116,466	M1L	probably benign	Het
Abca15	A	T	7: 120,401,833	I1531L	probably benign	Het
Adam28	T	C	14: 68,607,465	Y791C	probably benign	Het
Ankrd40	T	A	11: 94,338,361	I262N	probably damaging	Het
BC067074	G	A	13: 113,319,480	V687M		Het
Catsperg2	A	T	7: 29,698,188	N1033K	possibly damaging	Het
Cdh10	A	T	15: 18,963,995	D81V	probably damaging	Het
Cep78	T	C	19: 15,974,466	Y325C	probably damaging	Het
Clstn3	T	A	6: 124,459,768	D197V	probably damaging	Het
Col11a1	T	C	3: 114,212,160	I1647T	unknown	Het
Col5a1	G	A	2: 27,964,111	R569K	unknown	Het
Cyp4a10	T	C	4: 115,524,278	S180P	probably benign	Het
D630045J12Rik	T	C	6: 38,158,238	I1336V	probably benign	Het
Dchs2	G	A	3: 83,270,477	V946M	probably damaging	Het
Dnah10	A	G	5: 124,736,836	R347G	probably damaging	Het
Dnah11	T	A	12: 118,027,527	D2368V	probably damaging	Het
Ganab	T	C	19: 8,912,864	I719T	possibly damaging	Het
Gm10944	C	A	10: 10,681,839	A11D	unknown	Het
Gmcl1	T	C	6: 86,714,213	M267V	probably benign	Het
Inhbe	T	A	10: 127,350,558	D251V	probably damaging	Het
Kcnj1	G	A	9: 32,396,358	R26Q	probably benign	Het
Lama5	A	G	2: 180,196,478		probably benign	Het
Lin9	T	A	1: 180,667,347	D251E	probably damaging	Het
Magel2	T	A	7: 62,378,596	I416N	possibly damaging	Het
Mdga2	T	C	12: 66,513,283	N772S	probably damaging	Het
Msh3	G	T	13: 92,349,304	Q171K	probably benign	Het
Mslnl	T	G	17: 25,742,532		probably benign	Het
Mtpn	A	G	6: 35,512,241	L116P	possibly damaging	Het
Myh7	T	C	14: 54,975,997	T1351A	probably benign	Het
Nectin3	A	T	16: 46,454,635	I353N	probably damaging	Het
Nprl3	A	T	11: 32,233,948	N500K	probably benign	Het
Nup93	T	A	8: 94,292,720	I181N	probably benign	Het
Olfr1198	T	C	2: 88,746,432	H152R	probably damaging	Het
Olfr362	G	A	2: 37,104,789	T287I	probably damaging	Het
Optc	T	C	1: 133,905,240	I41V	probably benign	Het
Pcdh7	C	A	5: 58,129,321	N1246K	probably benign	Het
Pcdhb3	T	A	18: 37,302,113	D377E	probably benign	Het
Pnpla6	C	T	8: 3,523,294	P386L	probably benign	Het
Polr3a	T	C	14: 24,470,831	T587A	probably benign	Het
Pramel1	T	G	4: 143,398,529	L341R	probably damaging	Het
Rhot2	A	T	17: 25,841,766	N210K	probably damaging	Het
Slc37a1	A	G	17: 31,300,485	I12V	probably benign	Het
Spata48	T	A	11: 11,464,678	D141E		Het
Sstr3	G	T	15: 78,539,592	N318K	probably damaging	Het
Ssx2ip	T	C	3: 146,437,200	V511A	probably benign	Het
Stfa1	G	A	16: 36,280,568	V57I	unknown	Het
Syne1	T	G	10: 5,262,793	R3265S	probably damaging	Het
Tacc2	G	T	7: 130,626,803	K1739N	probably damaging	Het
Tas2r143	A	T	6: 42,400,739	M168L	probably benign	Het
Tm4sf1	A	T	3: 57,294,610		probably null	Het
Ttc16	A	G	2: 32,763,005	I604T	possibly damaging	Het
Ugt1a10	T	A	1: 88,055,671	W64R	possibly damaging	Het
Usp34	A	T	11: 23,489,064	H3561L		Het
Vasp	C	T	7: 19,259,451	V276I	unknown	Het
Vwa3a	A	G	7: 120,775,464	N333S	probably benign	Het
Wipf3	A	G	6: 54,483,881	N105D	probably benign	Het
Zfp760	T	C	17: 21,723,682	S613P	possibly damaging	Het

Other mutations in Cep290

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Cep290	APN	10	100508724	missense	probably benign	0.00
IGL00499:Cep290	APN	10	100543327	missense	probably damaging	1.00
IGL00547:Cep290	APN	10	100510708	missense	probably damaging	0.99
IGL00573:Cep290	APN	10	100540361	missense	probably damaging	1.00
IGL00646:Cep290	APN	10	100501154	missense	probably benign	0.15
IGL00755:Cep290	APN	10	100531104	missense	probably damaging	1.00
IGL00835:Cep290	APN	10	100563380	nonsense	probably null
IGL00846:Cep290	APN	10	100540333	splice site	probably benign
IGL00985:Cep290	APN	10	100567161	splice site	probably benign
IGL01687:Cep290	APN	10	100500205	missense	probably damaging	1.00
IGL01782:Cep290	APN	10	100545125	nonsense	probably null
IGL02010:Cep290	APN	10	100508707	missense	probably benign	0.39
IGL02010:Cep290	APN	10	100561345	missense	probably benign	0.00
IGL02036:Cep290	APN	10	100558100	nonsense	probably null
IGL02039:Cep290	APN	10	100514602	critical splice donor site	probably null
IGL02532:Cep290	APN	10	100545065	missense	probably benign	0.04
IGL02950:Cep290	APN	10	100540329	splice site	probably benign
IGL03105:Cep290	APN	10	100551824	missense	possibly damaging	0.66
IGL03179:Cep290	APN	10	100568088	missense	possibly damaging	0.60
IGL03271:Cep290	APN	10	100537801	missense	probably benign	0.09
IGL03401:Cep290	APN	10	100500265	missense	probably benign	0.27
PIT4687001:Cep290	UTSW	10	100537591	missense	probably benign	0.28
R0025:Cep290	UTSW	10	100537831	missense	probably damaging	1.00
R0127:Cep290	UTSW	10	100536925	splice site	probably benign
R0254:Cep290	UTSW	10	100514574	missense	probably benign	0.31
R0295:Cep290	UTSW	10	100537821	missense	probably damaging	0.99
R0371:Cep290	UTSW	10	100518564	splice site	probably benign
R0390:Cep290	UTSW	10	100508758	missense	probably benign	0.09
R0399:Cep290	UTSW	10	100554400	splice site	probably benign
R0413:Cep290	UTSW	10	100523314	nonsense	probably null
R0427:Cep290	UTSW	10	100516179	missense	probably benign	0.01
R0472:Cep290	UTSW	10	100551455	missense	probably benign	0.19
R0485:Cep290	UTSW	10	100549344	missense	possibly damaging	0.94
R0635:Cep290	UTSW	10	100492676	missense	probably damaging	1.00
R0675:Cep290	UTSW	10	100568813	critical splice acceptor site	probably null
R0972:Cep290	UTSW	10	100518762	missense	probably benign	0.08
R1238:Cep290	UTSW	10	100517863	missense	probably damaging	1.00
R1297:Cep290	UTSW	10	100539100	splice site	probably benign
R1368:Cep290	UTSW	10	100494966	splice site	probably benign
R1394:Cep290	UTSW	10	100537529	missense	possibly damaging	0.66
R1437:Cep290	UTSW	10	100572101	missense	probably benign	0.00
R1493:Cep290	UTSW	10	100562181	missense	probably benign	0.21
R1496:Cep290	UTSW	10	100538966	missense	probably damaging	1.00
R1539:Cep290	UTSW	10	100496828	missense	probably benign	0.06
R1598:Cep290	UTSW	10	100549329	missense	probably damaging	1.00
R1616:Cep290	UTSW	10	100568836	missense	probably benign
R1712:Cep290	UTSW	10	100554499	missense	probably benign	0.02
R1753:Cep290	UTSW	10	100513981	missense	probably benign
R1773:Cep290	UTSW	10	100510573	missense	probably benign
R1775:Cep290	UTSW	10	100496810	missense	probably damaging	0.98
R1799:Cep290	UTSW	10	100516196	missense	probably benign	0.00
R1937:Cep290	UTSW	10	100497953	missense	possibly damaging	0.71
R1991:Cep290	UTSW	10	100531184	missense	possibly damaging	0.80
R2031:Cep290	UTSW	10	100512400	critical splice donor site	probably null
R2164:Cep290	UTSW	10	100518795	missense	probably damaging	0.96
R2393:Cep290	UTSW	10	100561238	critical splice acceptor site	probably null
R2403:Cep290	UTSW	10	100537437	missense	probably benign	0.19
R3612:Cep290	UTSW	10	100541581	nonsense	probably null
R3800:Cep290	UTSW	10	100572941	missense	probably damaging	0.97
R4005:Cep290	UTSW	10	100539008	missense	probably damaging	1.00
R4039:Cep290	UTSW	10	100512401	critical splice donor site	probably null
R4259:Cep290	UTSW	10	100514492	missense	probably damaging	1.00
R4260:Cep290	UTSW	10	100514492	missense	probably damaging	1.00
R4319:Cep290	UTSW	10	100539047	missense	probably benign	0.09
R4329:Cep290	UTSW	10	100537668	missense	probably damaging	0.98
R4573:Cep290	UTSW	10	100518850	missense	probably benign
R4614:Cep290	UTSW	10	100508740	missense	probably benign
R4614:Cep290	UTSW	10	100559687	missense	possibly damaging	0.93
R4708:Cep290	UTSW	10	100523264	missense	probably benign	0.02
R4727:Cep290	UTSW	10	100563270	missense	probably benign	0.05
R4825:Cep290	UTSW	10	100488348	missense	probably damaging	0.96
R4839:Cep290	UTSW	10	100508786	missense	probably damaging	0.99
R4858:Cep290	UTSW	10	100494911	missense	probably benign	0.31
R4871:Cep290	UTSW	10	100548914	missense	probably benign	0.22
R5094:Cep290	UTSW	10	100567030	missense	probably damaging	0.97
R5103:Cep290	UTSW	10	100539020	missense	probably damaging	1.00
R5499:Cep290	UTSW	10	100537653	missense	probably damaging	0.99
R5505:Cep290	UTSW	10	100499186	critical splice donor site	probably null
R5615:Cep290	UTSW	10	100531150	missense	probably damaging	1.00
R5815:Cep290	UTSW	10	100558108	missense	possibly damaging	0.80
R5883:Cep290	UTSW	10	100523399	missense	probably benign	0.44
R5889:Cep290	UTSW	10	100499074	missense	possibly damaging	0.95
R5928:Cep290	UTSW	10	100551830	missense	probably damaging	0.99
R5992:Cep290	UTSW	10	100543321	missense	possibly damaging	0.73
R6000:Cep290	UTSW	10	100541787	missense	probably damaging	1.00
R6213:Cep290	UTSW	10	100523360	missense	probably benign	0.06
R6274:Cep290	UTSW	10	100530207	missense	probably damaging	1.00
R6285:Cep290	UTSW	10	100523329	missense	probably benign	0.17
R6306:Cep290	UTSW	10	100531166	missense	possibly damaging	0.89
R6593:Cep290	UTSW	10	100508776	missense	probably benign	0.01
R6649:Cep290	UTSW	10	100518531	missense	probably benign	0.28
R6692:Cep290	UTSW	10	100569144	splice site	probably null
R6788:Cep290	UTSW	10	100488628	missense	probably damaging	1.00
R6847:Cep290	UTSW	10	100563419	missense	probably damaging	1.00
R6947:Cep290	UTSW	10	100530056	missense	probably damaging	1.00
R7035:Cep290	UTSW	10	100499071	missense	probably benign	0.07
R7073:Cep290	UTSW	10	100539003	missense	possibly damaging	0.90
R7114:Cep290	UTSW	10	100543358	missense	probably damaging	0.98
R7256:Cep290	UTSW	10	100546498	missense	probably damaging	1.00
R7258:Cep290	UTSW	10	100499108	missense	probably benign	0.01
R7311:Cep290	UTSW	10	100537718	missense	probably damaging	0.98
R7505:Cep290	UTSW	10	100516265	missense	probably benign	0.01
R7615:Cep290	UTSW	10	100492681	missense	probably benign	0.03
R7643:Cep290	UTSW	10	100537553	missense	probably benign
R7662:Cep290	UTSW	10	100537803	missense	probably benign	0.21
R7663:Cep290	UTSW	10	100554536	critical splice donor site	probably null
R7685:Cep290	UTSW	10	100540057	missense	probably benign	0.19
R7699:Cep290	UTSW	10	100540369	missense	probably benign	0.33
R7717:Cep290	UTSW	10	100492681	missense	probably benign	0.03
R7747:Cep290	UTSW	10	100558176	nonsense	probably null
R7757:Cep290	UTSW	10	100563434	missense	probably benign
R7843:Cep290	UTSW	10	100516188	missense	possibly damaging	0.49
R7905:Cep290	UTSW	10	100554490	missense	probably benign
R8078:Cep290	UTSW	10	100572887	missense	probably benign	0.04
R8081:Cep290	UTSW	10	100558176	nonsense	probably null
R8094:Cep290	UTSW	10	100544931	missense	possibly damaging	0.95
R8266:Cep290	UTSW	10	100559671	missense	probably benign	0.08
R8305:Cep290	UTSW	10	100544934	missense	probably benign	0.09
R8325:Cep290	UTSW	10	100517808	missense	probably benign	0.03
R8372:Cep290	UTSW	10	100549341	missense	probably benign	0.00
R8443:Cep290	UTSW	10	100495844	missense	possibly damaging	0.80
R8497:Cep290	UTSW	10	100551458	missense	probably damaging	1.00
R8778:Cep290	UTSW	10	100514512	nonsense	probably null
R8975:Cep290	UTSW	10	100513920	missense	possibly damaging	0.54
R9146:Cep290	UTSW	10	100541803	missense	probably benign	0.44
R9374:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9448:Cep290	UTSW	10	100559684	missense	probably benign	0.32
R9499:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9507:Cep290	UTSW	10	100494923	missense	possibly damaging	0.81
R9539:Cep290	UTSW	10	100568851	missense	probably damaging	1.00
R9547:Cep290	UTSW	10	100544979	missense	probably benign	0.00
R9551:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9657:Cep290	UTSW	10	100515141	missense	possibly damaging	0.93
R9731:Cep290	UTSW	10	100510542	missense	probably damaging	0.98
R9756:Cep290	UTSW	10	100516172	missense	probably damaging	0.97
R9777:Cep290	UTSW	10	100518667	missense	probably benign	0.01
Z1176:Cep290	UTSW	10	100549374	critical splice donor site	probably benign
Z1177:Cep290	UTSW	10	100497944	missense	probably benign
Z1177:Cep290	UTSW	10	100538997	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGCACATGTAATATAGTGCAGCTG -3'
(R):5'- TTGCCTGGAAAGTGCTTGTC -3'

Sequencing Primer
(F):5'- CAGCTGTAAACATGTCTTTGTGC -3'
(R):5'- TGTCTAATAAATGAACAAGCTCGAGG -3'

Posted On

2022-03-25