Incidental Mutation 'R9264:Adam28'
ID 702445
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Name a disintegrin and metallopeptidase domain 28
Synonyms D430033C21Rik, C130072N01Rik, MDC-L, Dtgn1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 68606027-68655842 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68607465 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 791 (Y791C)
Ref Sequence ENSEMBL: ENSMUSP00000022642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
AlphaFold Q9JLN6
Predicted Effect probably benign
Transcript: ENSMUST00000022642
AA Change: Y791C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: Y791C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111072
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224039
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,116,466 M1L probably benign Het
Abca15 A T 7: 120,401,833 I1531L probably benign Het
Ankrd40 T A 11: 94,338,361 I262N probably damaging Het
BC067074 G A 13: 113,319,480 V687M Het
Catsperg2 A T 7: 29,698,188 N1033K possibly damaging Het
Cdh10 A T 15: 18,963,995 D81V probably damaging Het
Cep290 T C 10: 100,498,016 V310A possibly damaging Het
Cep78 T C 19: 15,974,466 Y325C probably damaging Het
Clstn3 T A 6: 124,459,768 D197V probably damaging Het
Col11a1 T C 3: 114,212,160 I1647T unknown Het
Col5a1 G A 2: 27,964,111 R569K unknown Het
Cyp4a10 T C 4: 115,524,278 S180P probably benign Het
D630045J12Rik T C 6: 38,158,238 I1336V probably benign Het
Dchs2 G A 3: 83,270,477 V946M probably damaging Het
Dnah10 A G 5: 124,736,836 R347G probably damaging Het
Dnah11 T A 12: 118,027,527 D2368V probably damaging Het
Ganab T C 19: 8,912,864 I719T possibly damaging Het
Gm10944 C A 10: 10,681,839 A11D unknown Het
Gmcl1 T C 6: 86,714,213 M267V probably benign Het
Inhbe T A 10: 127,350,558 D251V probably damaging Het
Kcnj1 G A 9: 32,396,358 R26Q probably benign Het
Lama5 A G 2: 180,196,478 probably benign Het
Lin9 T A 1: 180,667,347 D251E probably damaging Het
Magel2 T A 7: 62,378,596 I416N possibly damaging Het
Mdga2 T C 12: 66,513,283 N772S probably damaging Het
Msh3 G T 13: 92,349,304 Q171K probably benign Het
Mslnl T G 17: 25,742,532 probably benign Het
Mtpn A G 6: 35,512,241 L116P possibly damaging Het
Myh7 T C 14: 54,975,997 T1351A probably benign Het
Nectin3 A T 16: 46,454,635 I353N probably damaging Het
Nprl3 A T 11: 32,233,948 N500K probably benign Het
Nup93 T A 8: 94,292,720 I181N probably benign Het
Olfr1198 T C 2: 88,746,432 H152R probably damaging Het
Olfr362 G A 2: 37,104,789 T287I probably damaging Het
Optc T C 1: 133,905,240 I41V probably benign Het
Pcdh7 C A 5: 58,129,321 N1246K probably benign Het
Pcdhb3 T A 18: 37,302,113 D377E probably benign Het
Pnpla6 C T 8: 3,523,294 P386L probably benign Het
Polr3a T C 14: 24,470,831 T587A probably benign Het
Pramel1 T G 4: 143,398,529 L341R probably damaging Het
Rhot2 A T 17: 25,841,766 N210K probably damaging Het
Slc37a1 A G 17: 31,300,485 I12V probably benign Het
Spata48 T A 11: 11,464,678 D141E Het
Sstr3 G T 15: 78,539,592 N318K probably damaging Het
Ssx2ip T C 3: 146,437,200 V511A probably benign Het
Stfa1 G A 16: 36,280,568 V57I unknown Het
Syne1 T G 10: 5,262,793 R3265S probably damaging Het
Tacc2 G T 7: 130,626,803 K1739N probably damaging Het
Tas2r143 A T 6: 42,400,739 M168L probably benign Het
Tm4sf1 A T 3: 57,294,610 probably null Het
Ttc16 A G 2: 32,763,005 I604T possibly damaging Het
Ugt1a10 T A 1: 88,055,671 W64R possibly damaging Het
Usp34 A T 11: 23,489,064 H3561L Het
Vasp C T 7: 19,259,451 V276I unknown Het
Vwa3a A G 7: 120,775,464 N333S probably benign Het
Wipf3 A G 6: 54,483,881 N105D probably benign Het
Zfp760 T C 17: 21,723,682 S613P possibly damaging Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68622120 missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68649428 missense probably benign 0.00
IGL01021:Adam28 APN 14 68642114 missense probably benign
IGL01099:Adam28 APN 14 68637329 critical splice donor site probably null
IGL01349:Adam28 APN 14 68611006 missense probably benign 0.01
IGL01744:Adam28 APN 14 68607507 missense probably benign 0.07
IGL01805:Adam28 APN 14 68642091 missense probably benign 0.09
IGL02007:Adam28 APN 14 68633219 missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68646870 missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68637434 missense probably damaging 1.00
IGL03355:Adam28 APN 14 68634803 splice site probably benign
IGL02980:Adam28 UTSW 14 68619806 missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68634876 missense probably benign 0.00
R0184:Adam28 UTSW 14 68637373 missense probably benign 0.33
R0321:Adam28 UTSW 14 68617751 missense probably damaging 0.97
R0329:Adam28 UTSW 14 68617739 missense probably damaging 0.96
R0494:Adam28 UTSW 14 68630792 splice site probably benign
R0605:Adam28 UTSW 14 68606600 unclassified probably benign
R0732:Adam28 UTSW 14 68637347 missense probably benign 0.00
R0959:Adam28 UTSW 14 68607938 missense possibly damaging 0.93
R1319:Adam28 UTSW 14 68609129 missense probably benign 0.28
R1745:Adam28 UTSW 14 68633171 missense probably benign 0.04
R1836:Adam28 UTSW 14 68649421 missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68639195 missense probably benign 0.01
R1912:Adam28 UTSW 14 68644331 missense probably benign 0.24
R2830:Adam28 UTSW 14 68626914 missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68634845 missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3978:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3979:Adam28 UTSW 14 68610994 missense probably benign 0.20
R4282:Adam28 UTSW 14 68647706 missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68622082 critical splice donor site probably null
R4690:Adam28 UTSW 14 68642048 missense probably benign 0.01
R4724:Adam28 UTSW 14 68626877 missense probably damaging 0.99
R4768:Adam28 UTSW 14 68634815 missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68638103 missense probably damaging 0.99
R5054:Adam28 UTSW 14 68617715 missense probably damaging 1.00
R5710:Adam28 UTSW 14 68609908 missense probably damaging 0.96
R5835:Adam28 UTSW 14 68655681 missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68642062 missense probably benign
R6054:Adam28 UTSW 14 68642152 missense probably benign 0.01
R6349:Adam28 UTSW 14 68633172 missense probably benign 0.29
R6449:Adam28 UTSW 14 68630667 missense probably benign 0.31
R6455:Adam28 UTSW 14 68633208 missense probably damaging 1.00
R6831:Adam28 UTSW 14 68618127 missense probably benign 0.04
R6833:Adam28 UTSW 14 68618127 missense probably benign 0.04
R7212:Adam28 UTSW 14 68637397 missense probably damaging 0.99
R7411:Adam28 UTSW 14 68626947 missense probably damaging 1.00
R7422:Adam28 UTSW 14 68626877 missense probably damaging 1.00
R7516:Adam28 UTSW 14 68630676 missense probably damaging 1.00
R7649:Adam28 UTSW 14 68634833 missense probably benign 0.12
R7765:Adam28 UTSW 14 68609106 critical splice donor site probably null
R8469:Adam28 UTSW 14 68606580 missense probably benign 0.16
R8520:Adam28 UTSW 14 68642083 missense probably damaging 0.98
R9026:Adam28 UTSW 14 68609144 missense probably benign 0.16
R9163:Adam28 UTSW 14 68629082 missense probably damaging 0.98
R9304:Adam28 UTSW 14 68637497 missense probably damaging 1.00
R9357:Adam28 UTSW 14 68642030 missense probably benign 0.36
R9441:Adam28 UTSW 14 68637494 missense probably damaging 0.96
Z1177:Adam28 UTSW 14 68626784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTTGTGTTGCTAGGATAAACC -3'
(R):5'- CTGGATGCTCATTCTAGAGGC -3'

Sequencing Primer
(F):5'- GGATAAACCAGAAAATAGGTCTTCAC -3'
(R):5'- TCCACTCATGCGTAGTTC -3'
Posted On 2022-03-25