Mutagenetix > Incidental Mutation

Incidental Mutation 'R9264:Cdh10'

702446

Institutional Source

Beutler Lab

Gene Symbol

Cdh10

Ensembl Gene

ENSMUSG00000022321

Gene Name

cadherin 10

Synonyms

T2-cadherin, C030003B10Rik, C030011H18Rik, A830016G23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R9264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18818947-19014236 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 18963995 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 81 (D81V)

Ref Sequence

ENSEMBL: ENSMUSP00000135546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040562] [ENSMUST00000166873] [ENSMUST00000176146]

AlphaFold

P70408

Predicted Effect

probably damaging
Transcript: ENSMUST00000040562
AA Change: D81V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042199
Gene: ENSMUSG00000022321
AA Change: D81V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	77	158	2.8e-14	SMART
CA	182	267	1.03e-30	SMART
CA	291	383	6.04e-19	SMART
CA	406	487	6.23e-21	SMART
CA	510	594	3.56e-7	SMART
transmembrane domain	612	634	N/A	INTRINSIC
Pfam:Cadherin_C	635	782	9.2e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000166873
AA Change: D81V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128782
Gene: ENSMUSG00000022321
AA Change: D81V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	77	158	2.8e-14	SMART
CA	182	267	1.03e-30	SMART
CA	291	383	6.04e-19	SMART
CA	406	487	6.23e-21	SMART
CA	510	594	3.56e-7	SMART
transmembrane domain	612	634	N/A	INTRINSIC
Pfam:Cadherin_C	637	783	1.1e-54	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176146
AA Change: D81V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135546
Gene: ENSMUSG00000022321
AA Change: D81V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	77	158	2.8e-14	SMART
CA	182	267	1.03e-30	SMART
CA	291	383	6.04e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176593

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in the blood-brain barrier and retinal endothelia suggesting a role in the development and maintenance of brain barrier. Alternative splicing results in multiple transcript variants. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,116,466	M1L	probably benign	Het
Abca15	A	T	7: 120,401,833	I1531L	probably benign	Het
Adam28	T	C	14: 68,607,465	Y791C	probably benign	Het
Ankrd40	T	A	11: 94,338,361	I262N	probably damaging	Het
BC067074	G	A	13: 113,319,480	V687M		Het
Catsperg2	A	T	7: 29,698,188	N1033K	possibly damaging	Het
Cep290	T	C	10: 100,498,016	V310A	possibly damaging	Het
Cep78	T	C	19: 15,974,466	Y325C	probably damaging	Het
Clstn3	T	A	6: 124,459,768	D197V	probably damaging	Het
Col11a1	T	C	3: 114,212,160	I1647T	unknown	Het
Col5a1	G	A	2: 27,964,111	R569K	unknown	Het
Cyp4a10	T	C	4: 115,524,278	S180P	probably benign	Het
D630045J12Rik	T	C	6: 38,158,238	I1336V	probably benign	Het
Dchs2	G	A	3: 83,270,477	V946M	probably damaging	Het
Dnah10	A	G	5: 124,736,836	R347G	probably damaging	Het
Dnah11	T	A	12: 118,027,527	D2368V	probably damaging	Het
Ganab	T	C	19: 8,912,864	I719T	possibly damaging	Het
Gm10944	C	A	10: 10,681,839	A11D	unknown	Het
Gmcl1	T	C	6: 86,714,213	M267V	probably benign	Het
Inhbe	T	A	10: 127,350,558	D251V	probably damaging	Het
Kcnj1	G	A	9: 32,396,358	R26Q	probably benign	Het
Lama5	A	G	2: 180,196,478		probably benign	Het
Lin9	T	A	1: 180,667,347	D251E	probably damaging	Het
Magel2	T	A	7: 62,378,596	I416N	possibly damaging	Het
Mdga2	T	C	12: 66,513,283	N772S	probably damaging	Het
Msh3	G	T	13: 92,349,304	Q171K	probably benign	Het
Mslnl	T	G	17: 25,742,532		probably benign	Het
Mtpn	A	G	6: 35,512,241	L116P	possibly damaging	Het
Myh7	T	C	14: 54,975,997	T1351A	probably benign	Het
Nectin3	A	T	16: 46,454,635	I353N	probably damaging	Het
Nprl3	A	T	11: 32,233,948	N500K	probably benign	Het
Nup93	T	A	8: 94,292,720	I181N	probably benign	Het
Olfr1198	T	C	2: 88,746,432	H152R	probably damaging	Het
Olfr362	G	A	2: 37,104,789	T287I	probably damaging	Het
Optc	T	C	1: 133,905,240	I41V	probably benign	Het
Pcdh7	C	A	5: 58,129,321	N1246K	probably benign	Het
Pcdhb3	T	A	18: 37,302,113	D377E	probably benign	Het
Pnpla6	C	T	8: 3,523,294	P386L	probably benign	Het
Polr3a	T	C	14: 24,470,831	T587A	probably benign	Het
Pramel1	T	G	4: 143,398,529	L341R	probably damaging	Het
Rhot2	A	T	17: 25,841,766	N210K	probably damaging	Het
Slc37a1	A	G	17: 31,300,485	I12V	probably benign	Het
Spata48	T	A	11: 11,464,678	D141E		Het
Sstr3	G	T	15: 78,539,592	N318K	probably damaging	Het
Ssx2ip	T	C	3: 146,437,200	V511A	probably benign	Het
Stfa1	G	A	16: 36,280,568	V57I	unknown	Het
Syne1	T	G	10: 5,262,793	R3265S	probably damaging	Het
Tacc2	G	T	7: 130,626,803	K1739N	probably damaging	Het
Tas2r143	A	T	6: 42,400,739	M168L	probably benign	Het
Tm4sf1	A	T	3: 57,294,610		probably null	Het
Ttc16	A	G	2: 32,763,005	I604T	possibly damaging	Het
Ugt1a10	T	A	1: 88,055,671	W64R	possibly damaging	Het
Usp34	A	T	11: 23,489,064	H3561L		Het
Vasp	C	T	7: 19,259,451	V276I	unknown	Het
Vwa3a	A	G	7: 120,775,464	N333S	probably benign	Het
Wipf3	A	G	6: 54,483,881	N105D	probably benign	Het
Zfp760	T	C	17: 21,723,682	S613P	possibly damaging	Het

Other mutations in Cdh10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Cdh10	APN	15	19013263	missense	probably damaging	1.00
IGL00540:Cdh10	APN	15	18963995	missense	probably damaging	1.00
IGL00769:Cdh10	APN	15	18985099	missense	possibly damaging	0.63
IGL00837:Cdh10	APN	15	19013404	missense	probably benign
IGL01307:Cdh10	APN	15	18899800	missense	probably benign	0.34
IGL01509:Cdh10	APN	15	18986798	missense	possibly damaging	0.70
IGL01561:Cdh10	APN	15	18999926	missense	possibly damaging	0.52
IGL01743:Cdh10	APN	15	18986769	missense	probably benign	0.06
IGL02065:Cdh10	APN	15	19013256	missense	probably damaging	1.00
IGL02083:Cdh10	APN	15	18986889	missense	possibly damaging	0.79
IGL02238:Cdh10	APN	15	19013519	missense	probably damaging	1.00
IGL02838:Cdh10	APN	15	18899763	missense	probably damaging	1.00
IGL03397:Cdh10	APN	15	18964028	missense	probably damaging	1.00
R0423:Cdh10	UTSW	15	18986879	missense	probably benign	0.00
R0828:Cdh10	UTSW	15	18986751	missense	possibly damaging	0.52
R1488:Cdh10	UTSW	15	19013263	missense	probably damaging	1.00
R1563:Cdh10	UTSW	15	18986767	nonsense	probably null
R1674:Cdh10	UTSW	15	18985066	missense	probably benign	0.11
R1674:Cdh10	UTSW	15	19013330	missense	probably damaging	1.00
R1737:Cdh10	UTSW	15	18964063	missense	probably damaging	1.00
R1819:Cdh10	UTSW	15	18991965	nonsense	probably null
R1865:Cdh10	UTSW	15	18899604	missense	probably benign	0.01
R1953:Cdh10	UTSW	15	18966911	critical splice donor site	probably null
R2439:Cdh10	UTSW	15	19013398	missense	probably damaging	1.00
R3944:Cdh10	UTSW	15	18964249	missense	probably benign
R4320:Cdh10	UTSW	15	18985165	missense	probably benign	0.03
R4330:Cdh10	UTSW	15	18999959	missense	probably damaging	1.00
R4765:Cdh10	UTSW	15	19013278	missense	probably damaging	0.98
R4831:Cdh10	UTSW	15	19013578	missense	probably benign	0.10
R5102:Cdh10	UTSW	15	18986885	missense	probably benign	0.05
R5166:Cdh10	UTSW	15	19013360	missense	probably damaging	0.99
R5217:Cdh10	UTSW	15	18966022	missense	probably damaging	0.98
R5843:Cdh10	UTSW	15	18985200	missense	possibly damaging	0.68
R5902:Cdh10	UTSW	15	18985255	critical splice donor site	probably null
R6263:Cdh10	UTSW	15	18964068	missense	possibly damaging	0.86
R6636:Cdh10	UTSW	15	18985173	missense	probably damaging	0.99
R6770:Cdh10	UTSW	15	18985222	missense	probably benign	0.09
R7046:Cdh10	UTSW	15	19013201	missense	probably damaging	0.98
R7362:Cdh10	UTSW	15	18899694	missense	probably benign
R7491:Cdh10	UTSW	15	19013359	missense	probably damaging	0.99
R7921:Cdh10	UTSW	15	18991956	missense	probably damaging	1.00
R7937:Cdh10	UTSW	15	18964249	missense	probably benign
R8685:Cdh10	UTSW	15	18899765	missense	possibly damaging	0.89
R8843:Cdh10	UTSW	15	19013401	missense	possibly damaging	0.83
R8907:Cdh10	UTSW	15	19013435	missense	probably damaging	1.00
R9121:Cdh10	UTSW	15	19010988	missense	probably damaging	1.00
R9449:Cdh10	UTSW	15	19013435	missense	possibly damaging	0.89
R9497:Cdh10	UTSW	15	18964181	missense	probably damaging	0.98
R9584:Cdh10	UTSW	15	18992009	missense	probably benign	0.07
R9638:Cdh10	UTSW	15	18964215	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTACATGATCTTGCTGGTCC -3'
(R):5'- GGCTCATTGTCATTGATATCATGG -3'

Sequencing Primer
(F):5'- CCTTGGGTATGATAGGAGCTACTC -3'
(R):5'- CTGGTTCTACTGGCCTCAGAG -3'

Posted On

2022-03-25