Incidental Mutation 'R9264:Sstr3'
ID 702447
Institutional Source Beutler Lab
Gene Symbol Sstr3
Ensembl Gene ENSMUSG00000044933
Gene Name somatostatin receptor 3
Synonyms Smstr-3, Smstr3, sst3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 78421208-78428885 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 78423792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 318 (N318K)
Ref Sequence ENSEMBL: ENSMUSP00000058040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053239] [ENSMUST00000230400]
AlphaFold P30935
Predicted Effect probably damaging
Transcript: ENSMUST00000053239
AA Change: N318K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058040
Gene: ENSMUSG00000044933
AA Change: N318K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 291 1.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 337 3.5e-15 PFAM
Pfam:7tm_1 62 322 6.3e-60 PFAM
Pfam:7TM_GPCR_Srv 121 337 9.5e-8 PFAM
coiled coil region 355 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230400
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Sstr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sstr3 APN 15 78,424,667 (GRCm39) missense probably benign 0.00
R0442:Sstr3 UTSW 15 78,424,597 (GRCm39) missense probably damaging 0.99
R1714:Sstr3 UTSW 15 78,424,473 (GRCm39) missense probably damaging 1.00
R1865:Sstr3 UTSW 15 78,424,168 (GRCm39) missense probably damaging 1.00
R2008:Sstr3 UTSW 15 78,424,711 (GRCm39) missense probably benign 0.14
R2351:Sstr3 UTSW 15 78,424,121 (GRCm39) missense probably benign 0.01
R3023:Sstr3 UTSW 15 78,424,187 (GRCm39) missense probably damaging 0.99
R3024:Sstr3 UTSW 15 78,424,187 (GRCm39) missense probably damaging 0.99
R3770:Sstr3 UTSW 15 78,424,577 (GRCm39) missense probably damaging 1.00
R4399:Sstr3 UTSW 15 78,424,324 (GRCm39) missense probably damaging 1.00
R4724:Sstr3 UTSW 15 78,423,897 (GRCm39) nonsense probably null
R6181:Sstr3 UTSW 15 78,423,661 (GRCm39) missense probably benign
R6247:Sstr3 UTSW 15 78,423,788 (GRCm39) missense probably damaging 0.99
R7450:Sstr3 UTSW 15 78,424,043 (GRCm39) missense probably damaging 1.00
R7578:Sstr3 UTSW 15 78,424,717 (GRCm39) missense probably benign
R7793:Sstr3 UTSW 15 78,424,588 (GRCm39) missense probably damaging 1.00
R8336:Sstr3 UTSW 15 78,424,693 (GRCm39) missense probably damaging 1.00
R9263:Sstr3 UTSW 15 78,423,792 (GRCm39) missense probably damaging 1.00
R9265:Sstr3 UTSW 15 78,423,792 (GRCm39) missense probably damaging 1.00
X0026:Sstr3 UTSW 15 78,423,574 (GRCm39) missense possibly damaging 0.57
Z1177:Sstr3 UTSW 15 78,423,503 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCTGTTGTCCACTAGTGC -3'
(R):5'- GCTCATTGTGGTAAAGGTGC -3'

Sequencing Primer
(F):5'- TGTGCGATCTGACTGAGCCTC -3'
(R):5'- TAAAGGTGCGGTCGACCAC -3'
Posted On 2022-03-25