Mutagenetix > Incidental Mutation

Incidental Mutation 'R9264:Sstr3'

702447

Institutional Source

Beutler Lab

Gene Symbol

Sstr3

Ensembl Gene

ENSMUSG00000044933

Gene Name

somatostatin receptor 3

Synonyms

sst3, Smstr-3, Smstr3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78537008-78544685 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 78539592 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 318 (N318K)

Ref Sequence

ENSEMBL: ENSMUSP00000058040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053239] [ENSMUST00000230400]

AlphaFold

P30935

Predicted Effect

probably damaging
Transcript: ENSMUST00000053239
AA Change: N318K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058040
Gene: ENSMUSG00000044933
AA Change: N318K

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	53	291	1.9e-8	PFAM
Pfam:7TM_GPCR_Srsx	56	337	3.5e-15	PFAM
Pfam:7tm_1	62	322	6.3e-60	PFAM
Pfam:7TM_GPCR_Srv	121	337	9.5e-8	PFAM
coiled coil region	355	388	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000230400

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,116,466	M1L	probably benign	Het
Abca15	A	T	7: 120,401,833	I1531L	probably benign	Het
Adam28	T	C	14: 68,607,465	Y791C	probably benign	Het
Ankrd40	T	A	11: 94,338,361	I262N	probably damaging	Het
BC067074	G	A	13: 113,319,480	V687M		Het
Catsperg2	A	T	7: 29,698,188	N1033K	possibly damaging	Het
Cdh10	A	T	15: 18,963,995	D81V	probably damaging	Het
Cep290	T	C	10: 100,498,016	V310A	possibly damaging	Het
Cep78	T	C	19: 15,974,466	Y325C	probably damaging	Het
Clstn3	T	A	6: 124,459,768	D197V	probably damaging	Het
Col11a1	T	C	3: 114,212,160	I1647T	unknown	Het
Col5a1	G	A	2: 27,964,111	R569K	unknown	Het
Cyp4a10	T	C	4: 115,524,278	S180P	probably benign	Het
D630045J12Rik	T	C	6: 38,158,238	I1336V	probably benign	Het
Dchs2	G	A	3: 83,270,477	V946M	probably damaging	Het
Dnah10	A	G	5: 124,736,836	R347G	probably damaging	Het
Dnah11	T	A	12: 118,027,527	D2368V	probably damaging	Het
Ganab	T	C	19: 8,912,864	I719T	possibly damaging	Het
Gm10944	C	A	10: 10,681,839	A11D	unknown	Het
Gmcl1	T	C	6: 86,714,213	M267V	probably benign	Het
Inhbe	T	A	10: 127,350,558	D251V	probably damaging	Het
Kcnj1	G	A	9: 32,396,358	R26Q	probably benign	Het
Lama5	A	G	2: 180,196,478		probably benign	Het
Lin9	T	A	1: 180,667,347	D251E	probably damaging	Het
Magel2	T	A	7: 62,378,596	I416N	possibly damaging	Het
Mdga2	T	C	12: 66,513,283	N772S	probably damaging	Het
Msh3	G	T	13: 92,349,304	Q171K	probably benign	Het
Mslnl	T	G	17: 25,742,532		probably benign	Het
Mtpn	A	G	6: 35,512,241	L116P	possibly damaging	Het
Myh7	T	C	14: 54,975,997	T1351A	probably benign	Het
Nectin3	A	T	16: 46,454,635	I353N	probably damaging	Het
Nprl3	A	T	11: 32,233,948	N500K	probably benign	Het
Nup93	T	A	8: 94,292,720	I181N	probably benign	Het
Olfr1198	T	C	2: 88,746,432	H152R	probably damaging	Het
Olfr362	G	A	2: 37,104,789	T287I	probably damaging	Het
Optc	T	C	1: 133,905,240	I41V	probably benign	Het
Pcdh7	C	A	5: 58,129,321	N1246K	probably benign	Het
Pcdhb3	T	A	18: 37,302,113	D377E	probably benign	Het
Pnpla6	C	T	8: 3,523,294	P386L	probably benign	Het
Polr3a	T	C	14: 24,470,831	T587A	probably benign	Het
Pramel1	T	G	4: 143,398,529	L341R	probably damaging	Het
Rhot2	A	T	17: 25,841,766	N210K	probably damaging	Het
Slc37a1	A	G	17: 31,300,485	I12V	probably benign	Het
Spata48	T	A	11: 11,464,678	D141E		Het
Ssx2ip	T	C	3: 146,437,200	V511A	probably benign	Het
Stfa1	G	A	16: 36,280,568	V57I	unknown	Het
Syne1	T	G	10: 5,262,793	R3265S	probably damaging	Het
Tacc2	G	T	7: 130,626,803	K1739N	probably damaging	Het
Tas2r143	A	T	6: 42,400,739	M168L	probably benign	Het
Tm4sf1	A	T	3: 57,294,610		probably null	Het
Ttc16	A	G	2: 32,763,005	I604T	possibly damaging	Het
Ugt1a10	T	A	1: 88,055,671	W64R	possibly damaging	Het
Usp34	A	T	11: 23,489,064	H3561L		Het
Vasp	C	T	7: 19,259,451	V276I	unknown	Het
Vwa3a	A	G	7: 120,775,464	N333S	probably benign	Het
Wipf3	A	G	6: 54,483,881	N105D	probably benign	Het
Zfp760	T	C	17: 21,723,682	S613P	possibly damaging	Het

Other mutations in Sstr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sstr3	APN	15	78540467	missense	probably benign	0.00
R0442:Sstr3	UTSW	15	78540397	missense	probably damaging	0.99
R1714:Sstr3	UTSW	15	78540273	missense	probably damaging	1.00
R1865:Sstr3	UTSW	15	78539968	missense	probably damaging	1.00
R2008:Sstr3	UTSW	15	78540511	missense	probably benign	0.14
R2351:Sstr3	UTSW	15	78539921	missense	probably benign	0.01
R3023:Sstr3	UTSW	15	78539987	missense	probably damaging	0.99
R3024:Sstr3	UTSW	15	78539987	missense	probably damaging	0.99
R3770:Sstr3	UTSW	15	78540377	missense	probably damaging	1.00
R4399:Sstr3	UTSW	15	78540124	missense	probably damaging	1.00
R4724:Sstr3	UTSW	15	78539697	nonsense	probably null
R6181:Sstr3	UTSW	15	78539461	missense	probably benign
R6247:Sstr3	UTSW	15	78539588	missense	probably damaging	0.99
R7450:Sstr3	UTSW	15	78539843	missense	probably damaging	1.00
R7578:Sstr3	UTSW	15	78540517	missense	probably benign
R7793:Sstr3	UTSW	15	78540388	missense	probably damaging	1.00
R8336:Sstr3	UTSW	15	78540493	missense	probably damaging	1.00
R9263:Sstr3	UTSW	15	78539592	missense	probably damaging	1.00
R9265:Sstr3	UTSW	15	78539592	missense	probably damaging	1.00
X0026:Sstr3	UTSW	15	78539374	missense	possibly damaging	0.57
Z1177:Sstr3	UTSW	15	78539303	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCTGTTGTCCACTAGTGC -3'
(R):5'- GCTCATTGTGGTAAAGGTGC -3'

Sequencing Primer
(F):5'- TGTGCGATCTGACTGAGCCTC -3'
(R):5'- TAAAGGTGCGGTCGACCAC -3'

Posted On

2022-03-25