Incidental Mutation 'R9264:Nectin3'
ID 702449
Institutional Source Beutler Lab
Gene Symbol Nectin3
Ensembl Gene ENSMUSG00000022656
Gene Name nectin cell adhesion molecule 3
Synonyms 2610301B19Rik, nectin-3, 3000002N23Rik, Pvrl3, 4921513D19Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.269) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 46208069-46318888 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46274998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 353 (I353N)
Ref Sequence ENSEMBL: ENSMUSP00000023334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023334] [ENSMUST00000023335] [ENSMUST00000096052]
AlphaFold Q9JLB9
Predicted Effect probably damaging
Transcript: ENSMUST00000023334
AA Change: I353N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023334
Gene: ENSMUSG00000022656
AA Change: I353N

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 1.5e-19 PFAM
Pfam:Ig_3 284 342 3.1e-6 PFAM
low complexity region 358 367 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000023335
AA Change: I353N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656
AA Change: I353N

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2.5e-19 PFAM
Pfam:Ig_2 281 355 1.3e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096052
AA Change: I353N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093757
Gene: ENSMUSG00000022656
AA Change: I353N

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2e-19 PFAM
Pfam:Ig_2 281 355 1e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149901
SMART Domains Protein: ENSMUSP00000117479
Gene: ENSMUSG00000022656

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:Ig_3 184 243 4.8e-5 PFAM
Meta Mutation Damage Score 0.5925 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Nectin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Nectin3 APN 16 46,279,216 (GRCm39) missense probably benign 0.23
R0373:Nectin3 UTSW 16 46,278,550 (GRCm39) missense probably damaging 0.99
R0550:Nectin3 UTSW 16 46,279,183 (GRCm39) missense possibly damaging 0.86
R1219:Nectin3 UTSW 16 46,275,042 (GRCm39) nonsense probably null
R1251:Nectin3 UTSW 16 46,284,205 (GRCm39) missense possibly damaging 0.82
R1398:Nectin3 UTSW 16 46,269,119 (GRCm39) missense possibly damaging 0.95
R1439:Nectin3 UTSW 16 46,268,757 (GRCm39) nonsense probably null
R2250:Nectin3 UTSW 16 46,275,099 (GRCm39) missense probably benign 0.00
R2448:Nectin3 UTSW 16 46,268,878 (GRCm39) splice site probably null
R2483:Nectin3 UTSW 16 46,215,542 (GRCm39) missense possibly damaging 0.83
R4523:Nectin3 UTSW 16 46,268,953 (GRCm39) missense probably benign 0.15
R4709:Nectin3 UTSW 16 46,284,306 (GRCm39) missense possibly damaging 0.58
R4809:Nectin3 UTSW 16 46,268,523 (GRCm39) intron probably benign
R4884:Nectin3 UTSW 16 46,269,249 (GRCm39) missense probably benign 0.01
R5051:Nectin3 UTSW 16 46,268,913 (GRCm39) missense possibly damaging 0.95
R5061:Nectin3 UTSW 16 46,268,812 (GRCm39) missense probably benign 0.03
R5272:Nectin3 UTSW 16 46,268,839 (GRCm39) missense possibly damaging 0.82
R5365:Nectin3 UTSW 16 46,284,469 (GRCm39) nonsense probably null
R5768:Nectin3 UTSW 16 46,279,180 (GRCm39) missense probably damaging 0.98
R5987:Nectin3 UTSW 16 46,284,508 (GRCm39) missense probably benign 0.00
R6029:Nectin3 UTSW 16 46,256,763 (GRCm39) missense probably benign 0.08
R6131:Nectin3 UTSW 16 46,215,515 (GRCm39) missense probably damaging 0.98
R6251:Nectin3 UTSW 16 46,215,513 (GRCm39) missense probably damaging 0.99
R6299:Nectin3 UTSW 16 46,284,345 (GRCm39) missense probably damaging 0.98
R6347:Nectin3 UTSW 16 46,278,487 (GRCm39) missense probably benign 0.01
R6360:Nectin3 UTSW 16 46,231,472 (GRCm39) missense probably benign 0.09
R6505:Nectin3 UTSW 16 46,269,184 (GRCm39) missense possibly damaging 0.68
R6703:Nectin3 UTSW 16 46,284,205 (GRCm39) missense probably damaging 0.99
R6869:Nectin3 UTSW 16 46,215,506 (GRCm39) missense probably damaging 0.96
R7184:Nectin3 UTSW 16 46,215,484 (GRCm39) missense possibly damaging 0.66
R7298:Nectin3 UTSW 16 46,268,759 (GRCm39) missense probably damaging 1.00
R7455:Nectin3 UTSW 16 46,317,105 (GRCm39) nonsense probably null
R7973:Nectin3 UTSW 16 46,216,484 (GRCm39) missense probably benign 0.13
R7993:Nectin3 UTSW 16 46,279,184 (GRCm39) missense probably benign 0.01
R8108:Nectin3 UTSW 16 46,284,484 (GRCm39) missense possibly damaging 0.84
R8259:Nectin3 UTSW 16 46,256,754 (GRCm39) missense probably benign 0.00
R8511:Nectin3 UTSW 16 46,284,363 (GRCm39) missense probably damaging 1.00
R8971:Nectin3 UTSW 16 46,269,265 (GRCm39) missense probably benign
R9195:Nectin3 UTSW 16 46,279,259 (GRCm39) nonsense probably null
R9492:Nectin3 UTSW 16 46,215,511 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACATCTTAGAGGCTCTTACTCTATC -3'
(R):5'- AGTGGACGTACTTAATGGACTTG -3'

Sequencing Primer
(F):5'- TTAGAGGCTCTTACTCTATCATAGC -3'
(R):5'- TGGACGTACTTAATGGACTTGTATAG -3'
Posted On 2022-03-25