Mutagenetix > Incidental Mutation

Incidental Mutation 'R9264:Nectin3'

702449

Institutional Source

Beutler Lab

Gene Symbol

Nectin3

Ensembl Gene

ENSMUSG00000022656

Gene Name

nectin cell adhesion molecule 3

Synonyms

3000002N23Rik, 2610301B19Rik, nectin-3, 4921513D19Rik, Pvrl3

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.259) question?

Stock #

R9264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46387706-46498525 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46454635 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 353 (I353N)

Ref Sequence

ENSEMBL: ENSMUSP00000023334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023334] [ENSMUST00000023335] [ENSMUST00000096052]

AlphaFold

Q9JLB9

Predicted Effect

probably damaging
Transcript: ENSMUST00000023334
AA Change: I353N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023334
Gene: ENSMUSG00000022656
AA Change: I353N

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
IG	63	167	5.04e-9	SMART
Pfam:C2-set_2	173	257	1.5e-19	PFAM
Pfam:Ig_3	284	342	3.1e-6	PFAM
low complexity region	358	367	N/A	INTRINSIC
transmembrane domain	404	426	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000023335
AA Change: I353N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656
AA Change: I353N

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
IG	63	167	5.04e-9	SMART
Pfam:C2-set_2	173	257	2.5e-19	PFAM
Pfam:Ig_2	281	355	1.3e-6	PFAM
transmembrane domain	368	390	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000096052
AA Change: I353N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093757
Gene: ENSMUSG00000022656
AA Change: I353N

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
IG	63	167	5.04e-9	SMART
Pfam:C2-set_2	173	257	2e-19	PFAM
Pfam:Ig_2	281	355	1e-6	PFAM
transmembrane domain	368	390	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000149901

SMART Domains

Protein: ENSMUSP00000117479
Gene: ENSMUSG00000022656

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
IG	63	167	5.04e-9	SMART
Pfam:Ig_3	184	243	4.8e-5	PFAM

Meta Mutation Damage Score

0.5925

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,116,466	M1L	probably benign	Het
Abca15	A	T	7: 120,401,833	I1531L	probably benign	Het
Adam28	T	C	14: 68,607,465	Y791C	probably benign	Het
Ankrd40	T	A	11: 94,338,361	I262N	probably damaging	Het
BC067074	G	A	13: 113,319,480	V687M		Het
Catsperg2	A	T	7: 29,698,188	N1033K	possibly damaging	Het
Cdh10	A	T	15: 18,963,995	D81V	probably damaging	Het
Cep290	T	C	10: 100,498,016	V310A	possibly damaging	Het
Cep78	T	C	19: 15,974,466	Y325C	probably damaging	Het
Clstn3	T	A	6: 124,459,768	D197V	probably damaging	Het
Col11a1	T	C	3: 114,212,160	I1647T	unknown	Het
Col5a1	G	A	2: 27,964,111	R569K	unknown	Het
Cyp4a10	T	C	4: 115,524,278	S180P	probably benign	Het
D630045J12Rik	T	C	6: 38,158,238	I1336V	probably benign	Het
Dchs2	G	A	3: 83,270,477	V946M	probably damaging	Het
Dnah10	A	G	5: 124,736,836	R347G	probably damaging	Het
Dnah11	T	A	12: 118,027,527	D2368V	probably damaging	Het
Ganab	T	C	19: 8,912,864	I719T	possibly damaging	Het
Gm10944	C	A	10: 10,681,839	A11D	unknown	Het
Gmcl1	T	C	6: 86,714,213	M267V	probably benign	Het
Inhbe	T	A	10: 127,350,558	D251V	probably damaging	Het
Kcnj1	G	A	9: 32,396,358	R26Q	probably benign	Het
Lama5	A	G	2: 180,196,478		probably benign	Het
Lin9	T	A	1: 180,667,347	D251E	probably damaging	Het
Magel2	T	A	7: 62,378,596	I416N	possibly damaging	Het
Mdga2	T	C	12: 66,513,283	N772S	probably damaging	Het
Msh3	G	T	13: 92,349,304	Q171K	probably benign	Het
Mslnl	T	G	17: 25,742,532		probably benign	Het
Mtpn	A	G	6: 35,512,241	L116P	possibly damaging	Het
Myh7	T	C	14: 54,975,997	T1351A	probably benign	Het
Nprl3	A	T	11: 32,233,948	N500K	probably benign	Het
Nup93	T	A	8: 94,292,720	I181N	probably benign	Het
Olfr1198	T	C	2: 88,746,432	H152R	probably damaging	Het
Olfr362	G	A	2: 37,104,789	T287I	probably damaging	Het
Optc	T	C	1: 133,905,240	I41V	probably benign	Het
Pcdh7	C	A	5: 58,129,321	N1246K	probably benign	Het
Pcdhb3	T	A	18: 37,302,113	D377E	probably benign	Het
Pnpla6	C	T	8: 3,523,294	P386L	probably benign	Het
Polr3a	T	C	14: 24,470,831	T587A	probably benign	Het
Pramel1	T	G	4: 143,398,529	L341R	probably damaging	Het
Rhot2	A	T	17: 25,841,766	N210K	probably damaging	Het
Slc37a1	A	G	17: 31,300,485	I12V	probably benign	Het
Spata48	T	A	11: 11,464,678	D141E		Het
Sstr3	G	T	15: 78,539,592	N318K	probably damaging	Het
Ssx2ip	T	C	3: 146,437,200	V511A	probably benign	Het
Stfa1	G	A	16: 36,280,568	V57I	unknown	Het
Syne1	T	G	10: 5,262,793	R3265S	probably damaging	Het
Tacc2	G	T	7: 130,626,803	K1739N	probably damaging	Het
Tas2r143	A	T	6: 42,400,739	M168L	probably benign	Het
Tm4sf1	A	T	3: 57,294,610		probably null	Het
Ttc16	A	G	2: 32,763,005	I604T	possibly damaging	Het
Ugt1a10	T	A	1: 88,055,671	W64R	possibly damaging	Het
Usp34	A	T	11: 23,489,064	H3561L		Het
Vasp	C	T	7: 19,259,451	V276I	unknown	Het
Vwa3a	A	G	7: 120,775,464	N333S	probably benign	Het
Wipf3	A	G	6: 54,483,881	N105D	probably benign	Het
Zfp760	T	C	17: 21,723,682	S613P	possibly damaging	Het

Other mutations in Nectin3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01456:Nectin3	APN	16	46458853	missense	probably benign	0.23
R0373:Nectin3	UTSW	16	46458187	missense	probably damaging	0.99
R0550:Nectin3	UTSW	16	46458820	missense	possibly damaging	0.86
R1219:Nectin3	UTSW	16	46454679	nonsense	probably null
R1251:Nectin3	UTSW	16	46463842	missense	possibly damaging	0.82
R1398:Nectin3	UTSW	16	46448756	missense	possibly damaging	0.95
R1439:Nectin3	UTSW	16	46448394	nonsense	probably null
R2250:Nectin3	UTSW	16	46454736	missense	probably benign	0.00
R2448:Nectin3	UTSW	16	46448515	splice site	probably null
R2483:Nectin3	UTSW	16	46395179	missense	possibly damaging	0.83
R4523:Nectin3	UTSW	16	46448590	missense	probably benign	0.15
R4709:Nectin3	UTSW	16	46463943	missense	possibly damaging	0.58
R4809:Nectin3	UTSW	16	46448160	intron	probably benign
R4884:Nectin3	UTSW	16	46448886	missense	probably benign	0.01
R5051:Nectin3	UTSW	16	46448550	missense	possibly damaging	0.95
R5061:Nectin3	UTSW	16	46448449	missense	probably benign	0.03
R5272:Nectin3	UTSW	16	46448476	missense	possibly damaging	0.82
R5365:Nectin3	UTSW	16	46464106	nonsense	probably null
R5768:Nectin3	UTSW	16	46458817	missense	probably damaging	0.98
R5987:Nectin3	UTSW	16	46464145	missense	probably benign	0.00
R6029:Nectin3	UTSW	16	46436400	missense	probably benign	0.08
R6131:Nectin3	UTSW	16	46395152	missense	probably damaging	0.98
R6251:Nectin3	UTSW	16	46395150	missense	probably damaging	0.99
R6299:Nectin3	UTSW	16	46463982	missense	probably damaging	0.98
R6347:Nectin3	UTSW	16	46458124	missense	probably benign	0.01
R6360:Nectin3	UTSW	16	46411109	missense	probably benign	0.09
R6505:Nectin3	UTSW	16	46448821	missense	possibly damaging	0.68
R6703:Nectin3	UTSW	16	46463842	missense	probably damaging	0.99
R6869:Nectin3	UTSW	16	46395143	missense	probably damaging	0.96
R7184:Nectin3	UTSW	16	46395121	missense	possibly damaging	0.66
R7298:Nectin3	UTSW	16	46448396	missense	probably damaging	1.00
R7455:Nectin3	UTSW	16	46496742	nonsense	probably null
R7973:Nectin3	UTSW	16	46396121	missense	probably benign	0.13
R7993:Nectin3	UTSW	16	46458821	missense	probably benign	0.01
R8108:Nectin3	UTSW	16	46464121	missense	possibly damaging	0.84
R8259:Nectin3	UTSW	16	46436391	missense	probably benign	0.00
R8511:Nectin3	UTSW	16	46464000	missense	probably damaging	1.00
R8971:Nectin3	UTSW	16	46448902	missense	probably benign
R9195:Nectin3	UTSW	16	46458896	nonsense	probably null
R9492:Nectin3	UTSW	16	46395148	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACACATCTTAGAGGCTCTTACTCTATC -3'
(R):5'- AGTGGACGTACTTAATGGACTTG -3'

Sequencing Primer
(F):5'- TTAGAGGCTCTTACTCTATCATAGC -3'
(R):5'- TGGACGTACTTAATGGACTTGTATAG -3'

Posted On

2022-03-25