Incidental Mutation 'R9264:Zfp760'
ID 702450
Institutional Source Beutler Lab
Gene Symbol Zfp760
Ensembl Gene ENSMUSG00000067928
Gene Name zinc finger protein 760
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 21926723-21944617 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21942663 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 613 (S613P)
Ref Sequence ENSEMBL: ENSMUSP00000073038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073312]
AlphaFold E9QAF5
Predicted Effect possibly damaging
Transcript: ENSMUST00000073312
AA Change: S613P

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073038
Gene: ENSMUSG00000067928
AA Change: S613P

DomainStartEndE-ValueType
KRAB 8 69 3.62e-21 SMART
ZnF_C2H2 183 202 1.78e2 SMART
ZnF_C2H2 208 230 1.69e-3 SMART
ZnF_C2H2 236 258 4.54e-4 SMART
ZnF_C2H2 264 286 2.79e-4 SMART
ZnF_C2H2 292 314 1.1e-2 SMART
ZnF_C2H2 320 342 2.71e-2 SMART
ZnF_C2H2 348 370 7.9e-4 SMART
ZnF_C2H2 376 398 1.72e-4 SMART
ZnF_C2H2 404 426 1.14e0 SMART
ZnF_C2H2 432 454 4.05e-1 SMART
ZnF_C2H2 460 482 5.14e-3 SMART
ZnF_C2H2 488 510 1.18e-2 SMART
ZnF_C2H2 516 538 1.95e-3 SMART
ZnF_C2H2 544 566 1.82e-3 SMART
ZnF_C2H2 572 594 4.17e-3 SMART
ZnF_C2H2 600 622 1.04e-3 SMART
ZnF_C2H2 628 650 1.28e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Other mutations in Zfp760
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Zfp760 APN 17 21,942,457 (GRCm39) missense possibly damaging 0.75
IGL00862:Zfp760 APN 17 21,941,265 (GRCm39) missense probably benign 0.00
IGL02198:Zfp760 APN 17 21,941,193 (GRCm39) missense probably benign 0.00
R0478:Zfp760 UTSW 17 21,940,995 (GRCm39) nonsense probably null
R0835:Zfp760 UTSW 17 21,942,559 (GRCm39) missense possibly damaging 0.63
R1191:Zfp760 UTSW 17 21,942,286 (GRCm39) missense probably damaging 1.00
R1760:Zfp760 UTSW 17 21,941,311 (GRCm39) missense probably damaging 1.00
R2698:Zfp760 UTSW 17 21,939,935 (GRCm39) missense probably damaging 0.99
R3722:Zfp760 UTSW 17 21,941,143 (GRCm39) missense probably damaging 1.00
R4561:Zfp760 UTSW 17 21,942,648 (GRCm39) missense probably benign 0.00
R4700:Zfp760 UTSW 17 21,941,388 (GRCm39) missense probably benign 0.01
R4859:Zfp760 UTSW 17 21,942,516 (GRCm39) nonsense probably null
R4859:Zfp760 UTSW 17 21,942,511 (GRCm39) missense probably damaging 0.97
R4897:Zfp760 UTSW 17 21,942,229 (GRCm39) missense probably benign 0.02
R6675:Zfp760 UTSW 17 21,941,991 (GRCm39) missense possibly damaging 0.92
R7286:Zfp760 UTSW 17 21,941,760 (GRCm39) missense probably benign 0.04
R7336:Zfp760 UTSW 17 21,942,814 (GRCm39) missense unknown
R7356:Zfp760 UTSW 17 21,941,601 (GRCm39) missense probably benign
R7369:Zfp760 UTSW 17 21,942,214 (GRCm39) missense probably benign 0.00
R7504:Zfp760 UTSW 17 21,941,655 (GRCm39) missense probably damaging 0.97
R7553:Zfp760 UTSW 17 21,941,872 (GRCm39) missense possibly damaging 0.82
R7577:Zfp760 UTSW 17 21,941,242 (GRCm39) nonsense probably null
R7579:Zfp760 UTSW 17 21,941,907 (GRCm39) missense possibly damaging 0.93
R7608:Zfp760 UTSW 17 21,941,797 (GRCm39) missense probably benign 0.00
R7973:Zfp760 UTSW 17 21,941,084 (GRCm39) missense probably benign 0.00
R8078:Zfp760 UTSW 17 21,942,436 (GRCm39) missense probably benign 0.27
R8332:Zfp760 UTSW 17 21,942,301 (GRCm39) missense probably damaging 0.99
R8750:Zfp760 UTSW 17 21,941,356 (GRCm39) missense possibly damaging 0.56
R9094:Zfp760 UTSW 17 21,941,932 (GRCm39) missense possibly damaging 0.86
R9372:Zfp760 UTSW 17 21,941,035 (GRCm39) missense probably benign 0.00
R9520:Zfp760 UTSW 17 21,941,036 (GRCm39) missense probably benign 0.00
R9564:Zfp760 UTSW 17 21,942,272 (GRCm39) missense possibly damaging 0.94
R9743:Zfp760 UTSW 17 21,942,338 (GRCm39) missense probably benign
X0057:Zfp760 UTSW 17 21,942,663 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGGAATGTGGTAAGTTCTTCCATTG -3'
(R):5'- GACAGTGAACATTCTTCTGGTTTAG -3'

Sequencing Primer
(F):5'- AGTTCTTCCATTGGTTGTCAAAC -3'
(R):5'- AGTTCTGGTTTGAATTTCTGACTAC -3'
Posted On 2022-03-25