Incidental Mutation 'R9264:Rhot2'
ID 702451
Institutional Source Beutler Lab
Gene Symbol Rhot2
Ensembl Gene ENSMUSG00000025733
Gene Name ras homolog family member T2
Synonyms Miro2, Arht2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.139) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 26057431-26063499 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26060740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 210 (N210K)
Ref Sequence ENSEMBL: ENSMUSP00000044639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026831] [ENSMUST00000043897] [ENSMUST00000079461] [ENSMUST00000176709] [ENSMUST00000176923] [ENSMUST00000183929] [ENSMUST00000184865]
AlphaFold Q8JZN7
Predicted Effect probably benign
Transcript: ENSMUST00000026831
SMART Domains Protein: ENSMUSP00000026831
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 5e-7 SMART
Blast:EFh 43 71 9e-11 BLAST
transmembrane domain 129 151 N/A INTRINSIC
Pfam:Rhomboid 174 331 6.7e-36 PFAM
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000043897
AA Change: N210K

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733
AA Change: N210K

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079461
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000176709
SMART Domains Protein: ENSMUSP00000135436
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Arf 1 121 1.6e-6 PFAM
Pfam:MMR_HSR1 6 118 1.4e-6 PFAM
Pfam:Miro 6 120 7.8e-20 PFAM
Pfam:Ras 6 121 7.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Predicted Effect probably benign
Transcript: ENSMUST00000176923
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183929
SMART Domains Protein: ENSMUSP00000139046
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 9e-6 SMART
Blast:EFh 43 70 2e-9 BLAST
transmembrane domain 136 155 N/A INTRINSIC
Pfam:Rhomboid 178 327 1e-27 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184865
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho family of GTPases. The encoded protein is localized to the outer mitochondrial membrane and plays a role in mitochondrial trafficking and fusion-fission dynamics. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal mitochondria distribution in neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Rhot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Rhot2 APN 17 26,060,334 (GRCm39) critical splice donor site probably null
IGL02707:Rhot2 APN 17 26,063,270 (GRCm39) missense probably damaging 1.00
IGL03087:Rhot2 APN 17 26,060,115 (GRCm39) unclassified probably benign
Endless UTSW 17 26,059,886 (GRCm39) missense probably damaging 1.00
eternal UTSW 17 26,061,402 (GRCm39) splice site probably null
ewige UTSW 17 26,058,394 (GRCm39) missense possibly damaging 0.69
R0634:Rhot2 UTSW 17 26,061,002 (GRCm39) missense possibly damaging 0.71
R1233:Rhot2 UTSW 17 26,063,071 (GRCm39) missense probably damaging 1.00
R1436:Rhot2 UTSW 17 26,060,374 (GRCm39) missense probably benign 0.16
R2902:Rhot2 UTSW 17 26,062,950 (GRCm39) missense probably damaging 0.99
R3617:Rhot2 UTSW 17 26,059,955 (GRCm39) unclassified probably benign
R3767:Rhot2 UTSW 17 26,059,521 (GRCm39) missense probably benign 0.11
R3768:Rhot2 UTSW 17 26,059,521 (GRCm39) missense probably benign 0.11
R3769:Rhot2 UTSW 17 26,059,521 (GRCm39) missense probably benign 0.11
R3770:Rhot2 UTSW 17 26,059,521 (GRCm39) missense probably benign 0.11
R4362:Rhot2 UTSW 17 26,061,065 (GRCm39) missense probably damaging 1.00
R4487:Rhot2 UTSW 17 26,058,467 (GRCm39) missense probably benign 0.01
R4670:Rhot2 UTSW 17 26,060,305 (GRCm39) unclassified probably benign
R4749:Rhot2 UTSW 17 26,063,248 (GRCm39) missense probably damaging 1.00
R5772:Rhot2 UTSW 17 26,058,781 (GRCm39) missense probably benign 0.00
R5840:Rhot2 UTSW 17 26,059,032 (GRCm39) missense probably benign
R5993:Rhot2 UTSW 17 26,060,085 (GRCm39) missense probably benign 0.45
R6479:Rhot2 UTSW 17 26,060,054 (GRCm39) missense probably benign 0.22
R6523:Rhot2 UTSW 17 26,058,394 (GRCm39) missense possibly damaging 0.69
R6597:Rhot2 UTSW 17 26,059,886 (GRCm39) missense probably damaging 1.00
R7269:Rhot2 UTSW 17 26,061,402 (GRCm39) splice site probably null
R7427:Rhot2 UTSW 17 26,060,583 (GRCm39) missense probably damaging 1.00
R7479:Rhot2 UTSW 17 26,059,723 (GRCm39) missense probably damaging 1.00
R7672:Rhot2 UTSW 17 26,062,079 (GRCm39) critical splice donor site probably null
R8176:Rhot2 UTSW 17 26,063,068 (GRCm39) missense probably damaging 1.00
R8258:Rhot2 UTSW 17 26,058,864 (GRCm39) missense probably benign 0.00
R8259:Rhot2 UTSW 17 26,058,864 (GRCm39) missense probably benign 0.00
R9409:Rhot2 UTSW 17 26,060,085 (GRCm39) missense probably benign 0.06
X0067:Rhot2 UTSW 17 26,060,440 (GRCm39) missense possibly damaging 0.84
Y5409:Rhot2 UTSW 17 26,063,269 (GRCm39) missense probably damaging 1.00
Z1177:Rhot2 UTSW 17 26,059,657 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAAGGTGATGTCTGCCTCAC -3'
(R):5'- TCCATGTGGGCCTTGGATAAG -3'

Sequencing Primer
(F):5'- AGCCGGTCATTCTGCACAC -3'
(R):5'- GGAGTACAAGTAAATACGCGTACC -3'
Posted On 2022-03-25