Incidental Mutation 'R9264:Pcdhb3'
ID 702453
Institutional Source Beutler Lab
Gene Symbol Pcdhb3
Ensembl Gene ENSMUSG00000045498
Gene Name protocadherin beta 3
Synonyms PcdhbC
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37433852-37437638 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37435166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 377 (D377E)
Ref Sequence ENSEMBL: ENSMUSP00000059180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056522] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91XZ7
Predicted Effect probably benign
Transcript: ENSMUST00000051754
AA Change: D377E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498
AA Change: D377E

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056522
SMART Domains Protein: ENSMUSP00000057921
Gene: ENSMUSG00000051599

DomainStartEndE-ValueType
Pfam:Cadherin_2 32 114 5.2e-33 PFAM
CA 157 242 1.74e-19 SMART
CA 266 347 5.99e-23 SMART
CA 370 451 1.16e-20 SMART
CA 475 561 5.94e-27 SMART
CA 591 672 2.03e-11 SMART
Pfam:Cadherin_C_2 688 771 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mslnl T G 17: 25,961,506 (GRCm39) probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Pcdhb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Pcdhb3 APN 18 37,436,001 (GRCm39) missense probably benign 0.12
IGL01568:Pcdhb3 APN 18 37,435,054 (GRCm39) missense possibly damaging 0.74
IGL02541:Pcdhb3 APN 18 37,435,198 (GRCm39) missense probably damaging 0.99
IGL02852:Pcdhb3 APN 18 37,435,150 (GRCm39) missense probably damaging 1.00
IGL03140:Pcdhb3 APN 18 37,434,272 (GRCm39) missense probably benign 0.00
IGL03336:Pcdhb3 APN 18 37,436,014 (GRCm39) missense possibly damaging 0.86
R0380:Pcdhb3 UTSW 18 37,435,210 (GRCm39) missense possibly damaging 0.48
R1558:Pcdhb3 UTSW 18 37,434,634 (GRCm39) missense probably damaging 1.00
R1713:Pcdhb3 UTSW 18 37,436,375 (GRCm39) missense probably benign
R1728:Pcdhb3 UTSW 18 37,434,931 (GRCm39) missense probably damaging 1.00
R1784:Pcdhb3 UTSW 18 37,434,931 (GRCm39) missense probably damaging 1.00
R1838:Pcdhb3 UTSW 18 37,434,370 (GRCm39) missense probably benign 0.00
R2079:Pcdhb3 UTSW 18 37,436,362 (GRCm39) missense possibly damaging 0.93
R2164:Pcdhb3 UTSW 18 37,435,239 (GRCm39) missense possibly damaging 0.78
R2513:Pcdhb3 UTSW 18 37,434,294 (GRCm39) missense probably benign 0.17
R2513:Pcdhb3 UTSW 18 37,434,292 (GRCm39) nonsense probably null
R2513:Pcdhb3 UTSW 18 37,434,293 (GRCm39) missense probably damaging 1.00
R3080:Pcdhb3 UTSW 18 37,434,535 (GRCm39) missense probably damaging 1.00
R3755:Pcdhb3 UTSW 18 37,435,878 (GRCm39) missense probably damaging 0.97
R3756:Pcdhb3 UTSW 18 37,435,878 (GRCm39) missense probably damaging 0.97
R3862:Pcdhb3 UTSW 18 37,436,329 (GRCm39) missense probably damaging 1.00
R3863:Pcdhb3 UTSW 18 37,436,329 (GRCm39) missense probably damaging 1.00
R3864:Pcdhb3 UTSW 18 37,436,329 (GRCm39) missense probably damaging 1.00
R4114:Pcdhb3 UTSW 18 37,435,093 (GRCm39) missense probably benign 0.03
R4895:Pcdhb3 UTSW 18 37,434,759 (GRCm39) missense probably damaging 1.00
R4917:Pcdhb3 UTSW 18 37,435,452 (GRCm39) missense probably damaging 0.99
R5508:Pcdhb3 UTSW 18 37,434,179 (GRCm39) missense probably damaging 1.00
R5779:Pcdhb3 UTSW 18 37,434,520 (GRCm39) missense probably benign 0.26
R5848:Pcdhb3 UTSW 18 37,434,700 (GRCm39) missense probably benign 0.39
R5991:Pcdhb3 UTSW 18 37,434,561 (GRCm39) missense probably benign 0.07
R6014:Pcdhb3 UTSW 18 37,435,706 (GRCm39) missense probably damaging 1.00
R6111:Pcdhb3 UTSW 18 37,435,242 (GRCm39) missense probably benign 0.00
R6282:Pcdhb3 UTSW 18 37,434,699 (GRCm39) missense probably damaging 1.00
R6339:Pcdhb3 UTSW 18 37,433,998 (GRCm39) intron probably benign
R6425:Pcdhb3 UTSW 18 37,435,528 (GRCm39) missense possibly damaging 0.64
R6860:Pcdhb3 UTSW 18 37,434,763 (GRCm39) missense probably benign 0.01
R6896:Pcdhb3 UTSW 18 37,434,265 (GRCm39) missense probably damaging 1.00
R6946:Pcdhb3 UTSW 18 37,435,672 (GRCm39) missense probably damaging 1.00
R7110:Pcdhb3 UTSW 18 37,435,975 (GRCm39) missense possibly damaging 0.87
R7236:Pcdhb3 UTSW 18 37,434,505 (GRCm39) missense probably damaging 1.00
R7402:Pcdhb3 UTSW 18 37,434,657 (GRCm39) missense probably benign
R7469:Pcdhb3 UTSW 18 37,434,388 (GRCm39) missense probably benign 0.02
R7723:Pcdhb3 UTSW 18 37,435,565 (GRCm39) missense probably damaging 0.98
R7738:Pcdhb3 UTSW 18 37,436,012 (GRCm39) missense probably benign 0.00
R7800:Pcdhb3 UTSW 18 37,434,974 (GRCm39) missense probably benign 0.00
R7817:Pcdhb3 UTSW 18 37,435,982 (GRCm39) missense probably benign
R8157:Pcdhb3 UTSW 18 37,436,292 (GRCm39) missense probably damaging 1.00
R9482:Pcdhb3 UTSW 18 37,434,736 (GRCm39) missense probably damaging 1.00
R9488:Pcdhb3 UTSW 18 37,435,416 (GRCm39) missense possibly damaging 0.62
X0026:Pcdhb3 UTSW 18 37,434,817 (GRCm39) missense probably damaging 0.96
X0066:Pcdhb3 UTSW 18 37,435,392 (GRCm39) nonsense probably null
Z1177:Pcdhb3 UTSW 18 37,435,089 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATACTTATGAGGTTGACATAGAGGCC -3'
(R):5'- CGTTGAGGTCAGACACTTGC -3'

Sequencing Primer
(F):5'- CAAGGATGGTGGAGGCCTTTC -3'
(R):5'- CAGACACTTGCACTGTTATGG -3'
Posted On 2022-03-25